ID: 1134972750

View in Genome Browser
Species Human (GRCh38)
Location 16:18544904-18544926
Sequence GTGACCGGAAGCAAGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134972750_1134972754 -8 Left 1134972750 16:18544904-18544926 CCCTCACACTTGCTTCCGGTCAC No data
Right 1134972754 16:18544919-18544941 CCGGTCACTAACACCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134972750 Original CRISPR GTGACCGGAAGCAAGTGTGA GGG (reversed) Intronic