ID: 1134972750 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:18544904-18544926 |
Sequence | GTGACCGGAAGCAAGTGTGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1134972750_1134972754 | -8 | Left | 1134972750 | 16:18544904-18544926 | CCCTCACACTTGCTTCCGGTCAC | No data | ||
Right | 1134972754 | 16:18544919-18544941 | CCGGTCACTAACACCCCAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1134972750 | Original CRISPR | GTGACCGGAAGCAAGTGTGA GGG (reversed) | Intronic | ||