ID: 1134972751

View in Genome Browser
Species Human (GRCh38)
Location 16:18544905-18544927
Sequence AGTGACCGGAAGCAAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134972751_1134972754 -9 Left 1134972751 16:18544905-18544927 CCTCACACTTGCTTCCGGTCACT No data
Right 1134972754 16:18544919-18544941 CCGGTCACTAACACCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134972751 Original CRISPR AGTGACCGGAAGCAAGTGTG AGG (reversed) Intronic