ID: 1134972754

View in Genome Browser
Species Human (GRCh38)
Location 16:18544919-18544941
Sequence CCGGTCACTAACACCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134972751_1134972754 -9 Left 1134972751 16:18544905-18544927 CCTCACACTTGCTTCCGGTCACT No data
Right 1134972754 16:18544919-18544941 CCGGTCACTAACACCCCAGGAGG No data
1134972748_1134972754 1 Left 1134972748 16:18544895-18544917 CCAGAAGTGCCCTCACACTTGCT No data
Right 1134972754 16:18544919-18544941 CCGGTCACTAACACCCCAGGAGG No data
1134972745_1134972754 24 Left 1134972745 16:18544872-18544894 CCCAACAGAAGAGCACCAGCAAG No data
Right 1134972754 16:18544919-18544941 CCGGTCACTAACACCCCAGGAGG No data
1134972747_1134972754 9 Left 1134972747 16:18544887-18544909 CCAGCAAGCCAGAAGTGCCCTCA No data
Right 1134972754 16:18544919-18544941 CCGGTCACTAACACCCCAGGAGG No data
1134972750_1134972754 -8 Left 1134972750 16:18544904-18544926 CCCTCACACTTGCTTCCGGTCAC No data
Right 1134972754 16:18544919-18544941 CCGGTCACTAACACCCCAGGAGG No data
1134972746_1134972754 23 Left 1134972746 16:18544873-18544895 CCAACAGAAGAGCACCAGCAAGC No data
Right 1134972754 16:18544919-18544941 CCGGTCACTAACACCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134972754 Original CRISPR CCGGTCACTAACACCCCAGG AGG Intronic
No off target data available for this crispr