ID: 1134973146

View in Genome Browser
Species Human (GRCh38)
Location 16:18549129-18549151
Sequence TATCAAGTAGAGTCCCACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134973146_1134973152 30 Left 1134973146 16:18549129-18549151 CCCCCGTGGGACTCTACTTGATA No data
Right 1134973152 16:18549182-18549204 TCTCCCTATGTTGTCCAGGCTGG 0: 184
1: 3589
2: 23594
3: 107825
4: 321000
1134973146_1134973150 -1 Left 1134973146 16:18549129-18549151 CCCCCGTGGGACTCTACTTGATA No data
Right 1134973150 16:18549151-18549173 ATAATTTTTTAAATTATTTGTGG No data
1134973146_1134973151 26 Left 1134973146 16:18549129-18549151 CCCCCGTGGGACTCTACTTGATA No data
Right 1134973151 16:18549178-18549200 TGAGTCTCCCTATGTTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134973146 Original CRISPR TATCAAGTAGAGTCCCACGG GGG (reversed) Intronic
No off target data available for this crispr