ID: 1134974312

View in Genome Browser
Species Human (GRCh38)
Location 16:18558690-18558712
Sequence CTGGGTTAACACTTCGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134974312_1134974319 26 Left 1134974312 16:18558690-18558712 CCAGACACGAAGTGTTAACCCAG No data
Right 1134974319 16:18558739-18558761 TTCCACGTGTTGTGTGGCCTTGG 0: 1
1: 2
2: 3
3: 24
4: 190
1134974312_1134974318 20 Left 1134974312 16:18558690-18558712 CCAGACACGAAGTGTTAACCCAG No data
Right 1134974318 16:18558733-18558755 TGAGTCTTCCACGTGTTGTGTGG 0: 1
1: 2
2: 0
3: 6
4: 86
1134974312_1134974320 27 Left 1134974312 16:18558690-18558712 CCAGACACGAAGTGTTAACCCAG No data
Right 1134974320 16:18558740-18558762 TCCACGTGTTGTGTGGCCTTGGG 0: 1
1: 2
2: 4
3: 31
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134974312 Original CRISPR CTGGGTTAACACTTCGTGTC TGG (reversed) Intronic
No off target data available for this crispr