ID: 1134974861

View in Genome Browser
Species Human (GRCh38)
Location 16:18562164-18562186
Sequence GCGCGCGTGCGCGGCGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 2, 1: 0, 2: 1, 3: 25, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134974861_1134974869 28 Left 1134974861 16:18562164-18562186 CCAGAGCCGCCGCGCACGCGCGC 0: 2
1: 0
2: 1
3: 25
4: 225
Right 1134974869 16:18562215-18562237 AGAGAACTAAGGCGCATGCTCGG 0: 3
1: 0
2: 0
3: 3
4: 77
1134974861_1134974865 17 Left 1134974861 16:18562164-18562186 CCAGAGCCGCCGCGCACGCGCGC 0: 2
1: 0
2: 1
3: 25
4: 225
Right 1134974865 16:18562204-18562226 AGCCCCAGAAGAGAGAACTAAGG 0: 3
1: 0
2: 1
3: 17
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134974861 Original CRISPR GCGCGCGTGCGCGGCGGCTC TGG (reversed) Intronic