ID: 1134974861 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:18562164-18562186 |
Sequence | GCGCGCGTGCGCGGCGGCTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 253 | |||
Summary | {0: 2, 1: 0, 2: 1, 3: 25, 4: 225} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1134974861_1134974869 | 28 | Left | 1134974861 | 16:18562164-18562186 | CCAGAGCCGCCGCGCACGCGCGC | 0: 2 1: 0 2: 1 3: 25 4: 225 |
||
Right | 1134974869 | 16:18562215-18562237 | AGAGAACTAAGGCGCATGCTCGG | 0: 3 1: 0 2: 0 3: 3 4: 77 |
||||
1134974861_1134974865 | 17 | Left | 1134974861 | 16:18562164-18562186 | CCAGAGCCGCCGCGCACGCGCGC | 0: 2 1: 0 2: 1 3: 25 4: 225 |
||
Right | 1134974865 | 16:18562204-18562226 | AGCCCCAGAAGAGAGAACTAAGG | 0: 3 1: 0 2: 1 3: 17 4: 227 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1134974861 | Original CRISPR | GCGCGCGTGCGCGGCGGCTC TGG (reversed) | Intronic | ||