ID: 1134975322

View in Genome Browser
Species Human (GRCh38)
Location 16:18566179-18566201
Sequence TATCACACCCACTTTGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134975318_1134975322 13 Left 1134975318 16:18566143-18566165 CCCACGGATATTAGGAATAATAT No data
Right 1134975322 16:18566179-18566201 TATCACACCCACTTTGATATTGG No data
1134975319_1134975322 12 Left 1134975319 16:18566144-18566166 CCACGGATATTAGGAATAATATC No data
Right 1134975322 16:18566179-18566201 TATCACACCCACTTTGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134975322 Original CRISPR TATCACACCCACTTTGATAT TGG Intergenic
No off target data available for this crispr