ID: 1134975334

View in Genome Browser
Species Human (GRCh38)
Location 16:18566305-18566327
Sequence GTGTAAACCCACTGTGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134975331_1134975334 5 Left 1134975331 16:18566277-18566299 CCTCAGATATTACAAATAATATC No data
Right 1134975334 16:18566305-18566327 GTGTAAACCCACTGTGATATTGG No data
1134975330_1134975334 9 Left 1134975330 16:18566273-18566295 CCTGCCTCAGATATTACAAATAA No data
Right 1134975334 16:18566305-18566327 GTGTAAACCCACTGTGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134975334 Original CRISPR GTGTAAACCCACTGTGATAT TGG Intergenic
No off target data available for this crispr