ID: 1134977228

View in Genome Browser
Species Human (GRCh38)
Location 16:18580307-18580329
Sequence CTGGGGGTCTTCAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134977228_1134977238 26 Left 1134977228 16:18580307-18580329 CCTTCTTCCCTGAAGACCCCCAG No data
Right 1134977238 16:18580356-18580378 CTCATTCCTGTTCCACTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134977228 Original CRISPR CTGGGGGTCTTCAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr