ID: 1134979273

View in Genome Browser
Species Human (GRCh38)
Location 16:18594072-18594094
Sequence CACCCAGCTCTGGCATGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134979273_1134979279 23 Left 1134979273 16:18594072-18594094 CCTGAGCATGCCAGAGCTGGGTG No data
Right 1134979279 16:18594118-18594140 CACATTTCCTTGAGCCTAAGAGG No data
1134979273_1134979280 27 Left 1134979273 16:18594072-18594094 CCTGAGCATGCCAGAGCTGGGTG No data
Right 1134979280 16:18594122-18594144 TTTCCTTGAGCCTAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134979273 Original CRISPR CACCCAGCTCTGGCATGCTC AGG (reversed) Intergenic
No off target data available for this crispr