ID: 1134980810

View in Genome Browser
Species Human (GRCh38)
Location 16:18607544-18607566
Sequence AGGATGAAAGTCACTCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134980810_1134980818 4 Left 1134980810 16:18607544-18607566 CCACAAAGAGTGACTTTCATCCT No data
Right 1134980818 16:18607571-18607593 CTAAGAAGCAGGGGCCCAATGGG No data
1134980810_1134980815 -5 Left 1134980810 16:18607544-18607566 CCACAAAGAGTGACTTTCATCCT No data
Right 1134980815 16:18607562-18607584 ATCCTTGGGCTAAGAAGCAGGGG No data
1134980810_1134980819 5 Left 1134980810 16:18607544-18607566 CCACAAAGAGTGACTTTCATCCT No data
Right 1134980819 16:18607572-18607594 TAAGAAGCAGGGGCCCAATGGGG No data
1134980810_1134980822 27 Left 1134980810 16:18607544-18607566 CCACAAAGAGTGACTTTCATCCT No data
Right 1134980822 16:18607594-18607616 GCAACTTGTCACATTCAATAAGG No data
1134980810_1134980817 3 Left 1134980810 16:18607544-18607566 CCACAAAGAGTGACTTTCATCCT No data
Right 1134980817 16:18607570-18607592 GCTAAGAAGCAGGGGCCCAATGG No data
1134980810_1134980814 -6 Left 1134980810 16:18607544-18607566 CCACAAAGAGTGACTTTCATCCT No data
Right 1134980814 16:18607561-18607583 CATCCTTGGGCTAAGAAGCAGGG No data
1134980810_1134980813 -7 Left 1134980810 16:18607544-18607566 CCACAAAGAGTGACTTTCATCCT No data
Right 1134980813 16:18607560-18607582 TCATCCTTGGGCTAAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134980810 Original CRISPR AGGATGAAAGTCACTCTTTG TGG (reversed) Intergenic
No off target data available for this crispr