ID: 1134980816

View in Genome Browser
Species Human (GRCh38)
Location 16:18607564-18607586
Sequence GGCCCCTGCTTCTTAGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134980816_1134980823 15 Left 1134980816 16:18607564-18607586 CCTTGGGCTAAGAAGCAGGGGCC No data
Right 1134980823 16:18607602-18607624 TCACATTCAATAAGGATTCTTGG No data
1134980816_1134980822 7 Left 1134980816 16:18607564-18607586 CCTTGGGCTAAGAAGCAGGGGCC No data
Right 1134980822 16:18607594-18607616 GCAACTTGTCACATTCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134980816 Original CRISPR GGCCCCTGCTTCTTAGCCCA AGG (reversed) Intergenic
No off target data available for this crispr