ID: 1134980822

View in Genome Browser
Species Human (GRCh38)
Location 16:18607594-18607616
Sequence GCAACTTGTCACATTCAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134980810_1134980822 27 Left 1134980810 16:18607544-18607566 CCACAAAGAGTGACTTTCATCCT No data
Right 1134980822 16:18607594-18607616 GCAACTTGTCACATTCAATAAGG No data
1134980816_1134980822 7 Left 1134980816 16:18607564-18607586 CCTTGGGCTAAGAAGCAGGGGCC No data
Right 1134980822 16:18607594-18607616 GCAACTTGTCACATTCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134980822 Original CRISPR GCAACTTGTCACATTCAATA AGG Intergenic
No off target data available for this crispr