ID: 1134981943

View in Genome Browser
Species Human (GRCh38)
Location 16:18617809-18617831
Sequence CCATGATGCTTGGCAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134981937_1134981943 20 Left 1134981937 16:18617766-18617788 CCAGCATCAGGGGTTTCATGTGG No data
Right 1134981943 16:18617809-18617831 CCATGATGCTTGGCAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134981943 Original CRISPR CCATGATGCTTGGCAAACAC AGG Intergenic
No off target data available for this crispr