ID: 1134982520

View in Genome Browser
Species Human (GRCh38)
Location 16:18624008-18624030
Sequence CTGGGCCCGGCCGGTGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134982520_1134982534 24 Left 1134982520 16:18624008-18624030 CCAATGTCACCGGCCGGGCCCAG No data
Right 1134982534 16:18624055-18624077 CTTTGGGAGGCCAAGGCGGGTGG 0: 17665
1: 104567
2: 162703
3: 161462
4: 107266
1134982520_1134982528 11 Left 1134982520 16:18624008-18624030 CCAATGTCACCGGCCGGGCCCAG No data
Right 1134982528 16:18624042-18624064 TGCAATCCCAGCACTTTGGGAGG 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
1134982520_1134982526 7 Left 1134982520 16:18624008-18624030 CCAATGTCACCGGCCGGGCCCAG No data
Right 1134982526 16:18624038-18624060 CATCTGCAATCCCAGCACTTTGG 0: 116
1: 6905
2: 86455
3: 219789
4: 255904
1134982520_1134982527 8 Left 1134982520 16:18624008-18624030 CCAATGTCACCGGCCGGGCCCAG No data
Right 1134982527 16:18624039-18624061 ATCTGCAATCCCAGCACTTTGGG 0: 121
1: 7362
2: 96240
3: 319882
4: 241108
1134982520_1134982530 17 Left 1134982520 16:18624008-18624030 CCAATGTCACCGGCCGGGCCCAG No data
Right 1134982530 16:18624048-18624070 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
1134982520_1134982533 21 Left 1134982520 16:18624008-18624030 CCAATGTCACCGGCCGGGCCCAG No data
Right 1134982533 16:18624052-18624074 GCACTTTGGGAGGCCAAGGCGGG 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
1134982520_1134982532 20 Left 1134982520 16:18624008-18624030 CCAATGTCACCGGCCGGGCCCAG No data
Right 1134982532 16:18624051-18624073 AGCACTTTGGGAGGCCAAGGCGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134982520 Original CRISPR CTGGGCCCGGCCGGTGACAT TGG (reversed) Intergenic
No off target data available for this crispr