ID: 1134985849

View in Genome Browser
Species Human (GRCh38)
Location 16:18651271-18651293
Sequence CCTAATTATCACAGTCCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134985843_1134985849 26 Left 1134985843 16:18651222-18651244 CCCTCTGGTTTCCTTTTTGCAAG No data
Right 1134985849 16:18651271-18651293 CCTAATTATCACAGTCCTTAAGG No data
1134985844_1134985849 25 Left 1134985844 16:18651223-18651245 CCTCTGGTTTCCTTTTTGCAAGT No data
Right 1134985849 16:18651271-18651293 CCTAATTATCACAGTCCTTAAGG No data
1134985845_1134985849 15 Left 1134985845 16:18651233-18651255 CCTTTTTGCAAGTCTCAGCAAAA No data
Right 1134985849 16:18651271-18651293 CCTAATTATCACAGTCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134985849 Original CRISPR CCTAATTATCACAGTCCTTA AGG Intergenic
No off target data available for this crispr