ID: 1134985990

View in Genome Browser
Species Human (GRCh38)
Location 16:18652720-18652742
Sequence AGTCAGCCCCAAGAGAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134985987_1134985990 27 Left 1134985987 16:18652670-18652692 CCTGATTTGTACTTACCTGTTTA No data
Right 1134985990 16:18652720-18652742 AGTCAGCCCCAAGAGAGAAGAGG No data
1134985988_1134985990 12 Left 1134985988 16:18652685-18652707 CCTGTTTAATGTCTGTCTTGTCT No data
Right 1134985990 16:18652720-18652742 AGTCAGCCCCAAGAGAGAAGAGG No data
1134985986_1134985990 30 Left 1134985986 16:18652667-18652689 CCGCCTGATTTGTACTTACCTGT No data
Right 1134985990 16:18652720-18652742 AGTCAGCCCCAAGAGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134985990 Original CRISPR AGTCAGCCCCAAGAGAGAAG AGG Intergenic
No off target data available for this crispr