ID: 1134986909

View in Genome Browser
Species Human (GRCh38)
Location 16:18660897-18660919
Sequence ATGCTTATGAGTGAGGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134986909_1134986912 15 Left 1134986909 16:18660897-18660919 CCCATAACCTCACTCATAAGCAT No data
Right 1134986912 16:18660935-18660957 ATTCCTTCATCTTCCAACCCAGG No data
1134986909_1134986913 16 Left 1134986909 16:18660897-18660919 CCCATAACCTCACTCATAAGCAT No data
Right 1134986913 16:18660936-18660958 TTCCTTCATCTTCCAACCCAGGG No data
1134986909_1134986916 23 Left 1134986909 16:18660897-18660919 CCCATAACCTCACTCATAAGCAT No data
Right 1134986916 16:18660943-18660965 ATCTTCCAACCCAGGGGCACAGG No data
1134986909_1134986921 29 Left 1134986909 16:18660897-18660919 CCCATAACCTCACTCATAAGCAT No data
Right 1134986921 16:18660949-18660971 CAACCCAGGGGCACAGGGGAGGG No data
1134986909_1134986918 25 Left 1134986909 16:18660897-18660919 CCCATAACCTCACTCATAAGCAT No data
Right 1134986918 16:18660945-18660967 CTTCCAACCCAGGGGCACAGGGG No data
1134986909_1134986922 30 Left 1134986909 16:18660897-18660919 CCCATAACCTCACTCATAAGCAT No data
Right 1134986922 16:18660950-18660972 AACCCAGGGGCACAGGGGAGGGG No data
1134986909_1134986914 17 Left 1134986909 16:18660897-18660919 CCCATAACCTCACTCATAAGCAT No data
Right 1134986914 16:18660937-18660959 TCCTTCATCTTCCAACCCAGGGG No data
1134986909_1134986920 28 Left 1134986909 16:18660897-18660919 CCCATAACCTCACTCATAAGCAT No data
Right 1134986920 16:18660948-18660970 CCAACCCAGGGGCACAGGGGAGG No data
1134986909_1134986917 24 Left 1134986909 16:18660897-18660919 CCCATAACCTCACTCATAAGCAT No data
Right 1134986917 16:18660944-18660966 TCTTCCAACCCAGGGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134986909 Original CRISPR ATGCTTATGAGTGAGGTTAT GGG (reversed) Intergenic
No off target data available for this crispr