ID: 1134986917

View in Genome Browser
Species Human (GRCh38)
Location 16:18660944-18660966
Sequence TCTTCCAACCCAGGGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134986910_1134986917 23 Left 1134986910 16:18660898-18660920 CCATAACCTCACTCATAAGCATT No data
Right 1134986917 16:18660944-18660966 TCTTCCAACCCAGGGGCACAGGG No data
1134986909_1134986917 24 Left 1134986909 16:18660897-18660919 CCCATAACCTCACTCATAAGCAT No data
Right 1134986917 16:18660944-18660966 TCTTCCAACCCAGGGGCACAGGG No data
1134986911_1134986917 17 Left 1134986911 16:18660904-18660926 CCTCACTCATAAGCATTTGTCTC No data
Right 1134986917 16:18660944-18660966 TCTTCCAACCCAGGGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134986917 Original CRISPR TCTTCCAACCCAGGGGCACA GGG Intergenic
No off target data available for this crispr