ID: 1134989246

View in Genome Browser
Species Human (GRCh38)
Location 16:18684598-18684620
Sequence CCACTTTCCCTGCCAACGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134989233_1134989246 22 Left 1134989233 16:18684553-18684575 CCCTGTAACTCTCTAAAATCTCC No data
Right 1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG No data
1134989243_1134989246 0 Left 1134989243 16:18684575-18684597 CCTCCTTGGACTAGGGGTGGGGA No data
Right 1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG No data
1134989232_1134989246 23 Left 1134989232 16:18684552-18684574 CCCCTGTAACTCTCTAAAATCTC No data
Right 1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG No data
1134989231_1134989246 24 Left 1134989231 16:18684551-18684573 CCCCCTGTAACTCTCTAAAATCT No data
Right 1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG No data
1134989234_1134989246 21 Left 1134989234 16:18684554-18684576 CCTGTAACTCTCTAAAATCTCCC No data
Right 1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG No data
1134989241_1134989246 1 Left 1134989241 16:18684574-18684596 CCCTCCTTGGACTAGGGGTGGGG No data
Right 1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG No data
1134989244_1134989246 -3 Left 1134989244 16:18684578-18684600 CCTTGGACTAGGGGTGGGGACCA No data
Right 1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134989246 Original CRISPR CCACTTTCCCTGCCAACGTC AGG Intergenic
No off target data available for this crispr