ID: 1134998864

View in Genome Browser
Species Human (GRCh38)
Location 16:18760016-18760038
Sequence GCGCAAGCCCAGACTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134998864_1134998872 29 Left 1134998864 16:18760016-18760038 CCAGCTCCAGTCTGGGCTTGCGC No data
Right 1134998872 16:18760068-18760090 GTCCTACCCTGCCACCTACAGGG No data
1134998864_1134998868 -3 Left 1134998864 16:18760016-18760038 CCAGCTCCAGTCTGGGCTTGCGC No data
Right 1134998868 16:18760036-18760058 CGCTCAGGGACCAATATTCCAGG No data
1134998864_1134998871 28 Left 1134998864 16:18760016-18760038 CCAGCTCCAGTCTGGGCTTGCGC No data
Right 1134998871 16:18760067-18760089 AGTCCTACCCTGCCACCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134998864 Original CRISPR GCGCAAGCCCAGACTGGAGC TGG (reversed) Intergenic
No off target data available for this crispr