ID: 1135003049

View in Genome Browser
Species Human (GRCh38)
Location 16:18793389-18793411
Sequence AATTGCTGCCTCCTTAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135003049_1135003050 -10 Left 1135003049 16:18793389-18793411 CCAACATTAAGGAGGCAGCAATT 0: 1
1: 0
2: 1
3: 23
4: 179
Right 1135003050 16:18793402-18793424 GGCAGCAATTAACCTGCTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135003049 Original CRISPR AATTGCTGCCTCCTTAATGT TGG (reversed) Intronic
900348639 1:2224399-2224421 CACTGCTGGCTCCTTAAGGTGGG + Intergenic
900784140 1:4637062-4637084 AATTGCTGCTTCCATAAAATGGG - Intergenic
906001786 1:42432663-42432685 AATAGCTACCTCATTAATGTTGG + Intronic
906529196 1:46513465-46513487 AACTACTGCCTCCTCAATCTTGG - Exonic
906782943 1:48588907-48588929 CATTGCAGCCTCCTTAAGGGTGG - Intronic
908045287 1:60161930-60161952 AATTGCTGCCTAATAAATTTTGG - Intergenic
911378613 1:97084058-97084080 CAATGCTGCCACCTTAATCTAGG + Intronic
912148994 1:106832991-106833013 AATAGCTTCCTGCTTAATGGTGG - Intergenic
913468083 1:119163701-119163723 ATTTGCTGCCACCTTGATCTTGG + Intergenic
916648734 1:166815810-166815832 AATTGCTGCCTCCTCTATGGTGG - Intergenic
919588428 1:199468858-199468880 ATCTGCCGCCTCCTTGATGTTGG - Intergenic
924039111 1:239965808-239965830 AAATGCCTCCTACTTAATGTGGG + Intergenic
1064771712 10:18730207-18730229 AGGTGCTGCCCCCTTAATCTTGG - Intergenic
1066500923 10:35993912-35993934 ATTAACTGCCTCCTTCATGTGGG + Intergenic
1066628724 10:37437179-37437201 AATTGCTGCTTCATAAATGTTGG + Intergenic
1068021415 10:51589995-51590017 AAATGCAGCCTGCTTACTGTTGG + Intronic
1070282962 10:75063153-75063175 AGCTGCTGCCCCCTTAATGGAGG - Intergenic
1070489198 10:76960027-76960049 TATGGCTGCCTCCTTAAAGTGGG - Intronic
1071653110 10:87415880-87415902 AATTGCTGGCTCTATAATGGAGG - Intergenic
1073111062 10:101063262-101063284 AAAAGCTGCCACCTTAAGGTGGG + Intronic
1074140859 10:110671541-110671563 AGTTACTGCCTCTTTAAAGTGGG + Intronic
1074320197 10:112394603-112394625 AATGACTGCCTTTTTAATGTTGG - Intronic
1079016988 11:16877397-16877419 GATTGCTACCTCTTTATTGTGGG - Intronic
1081330822 11:41797563-41797585 AATTACTGGCTCCTTATTTTGGG - Intergenic
1082116458 11:48334967-48334989 AATTGCTGCCTTCATGGTGTAGG + Intergenic
1082177183 11:49074192-49074214 AAATGCTGCTTCCTGTATGTAGG - Intergenic
1082687505 11:56259034-56259056 AAATGCTGCCACCTTAATCTTGG - Intergenic
1084673428 11:70620868-70620890 AATTGCTGGCACCTTGATCTGGG + Intronic
1084749184 11:71192911-71192933 AAATACTGCATCCTTAATGGGGG + Intronic
1085279872 11:75323042-75323064 CATTGCTACCTCCCTAATCTGGG - Intronic
1085451393 11:76636147-76636169 AATTCCTTCCTCCTTAAAGCTGG - Intergenic
1086621800 11:88894913-88894935 ATTTGCTGCCACCTTGATCTTGG + Intronic
1086688524 11:89761648-89761670 AAATGCTGCTTCCTGTATGTAGG + Intergenic
1086717335 11:90078300-90078322 AAATGCTGCTTCCTGTATGTAGG - Intergenic
1087056288 11:93939735-93939757 AATTGCTGCATCCATCTTGTTGG - Intergenic
1088085340 11:105971605-105971627 AATGGCTGCCACATTTATGTGGG + Intronic
1088347967 11:108851387-108851409 AATTGGTGCCAACTTAATTTAGG + Intronic
1090148418 11:124354408-124354430 AGATGCTGCCACCTTAATGTTGG + Intergenic
1090286287 11:125502315-125502337 CATTGCTGCATCCTTAATTTTGG - Intergenic
1093144029 12:15543083-15543105 AATTTCTGCCTGATTAATTTAGG + Intronic
1093742338 12:22703285-22703307 AATTTCGGCCTCATTCATGTGGG - Intergenic
1097397213 12:59090282-59090304 AACTCCTGACTCCTTAATCTGGG + Intergenic
1097637266 12:62138080-62138102 AAATGCCGCCTCCTTTATGAGGG + Intronic
1101453084 12:104799484-104799506 ACTTGATGCCTCCAAAATGTGGG + Intergenic
1101756025 12:107621096-107621118 TGTTGCTGCCTCCTTACTGAAGG - Intronic
1107704599 13:43088338-43088360 CAATGCTGCCTCCTAAATCTGGG + Intronic
1108174513 13:47778353-47778375 AATTGATGCCTCCTTTAAGAAGG - Intergenic
1109397410 13:61778377-61778399 CATGGGTGCATCCTTAATGTTGG - Intergenic
1111188973 13:84783562-84783584 AACTGCTGCCTCATTATTTTTGG + Intergenic
1111293488 13:86198927-86198949 CAGTGCTGCCACCTTAATCTCGG + Intergenic
1111754060 13:92370426-92370448 AATTGATGATTCCTTAATATGGG + Intronic
1113025127 13:105931772-105931794 AATTTATTCCTCCTTAATTTGGG - Intergenic
1116752533 14:48904462-48904484 ACTTGCTGGCACCTTGATGTTGG + Intergenic
1119973110 14:78994479-78994501 CATTGCTGAGTCCTAAATGTAGG + Intronic
1120465030 14:84845431-84845453 AATTGATGCATACATAATGTTGG - Intergenic
1121187761 14:91991297-91991319 AGTTGCTGGCACCTTAATCTTGG + Intronic
1121778767 14:96608363-96608385 ACTTGCTGACTCCTTGATCTTGG - Intergenic
1121844625 14:97161957-97161979 CTTTGCTGGCTCCTTAATCTTGG - Intergenic
1125154321 15:36568930-36568952 ATTTGCTGGCTCCTTGATCTTGG + Intergenic
1129025673 15:72571415-72571437 AATAGCTGCTCCCATAATGTAGG + Intronic
1130891936 15:88140826-88140848 AACTGCTGCCTAGTTAATATGGG + Intronic
1131973333 15:97914856-97914878 TCTTGCTGTATCCTTAATGTGGG - Intergenic
1133537751 16:6718517-6718539 AAATGCTGCCTCCTTAAAGGTGG - Intronic
1134529713 16:14974026-14974048 GATTCCTCCCACCTTAATGTGGG - Intergenic
1135003049 16:18793389-18793411 AATTGCTGCCTCCTTAATGTTGG - Intronic
1137600313 16:49751981-49752003 ATTTGCTCCCTCCTTGCTGTGGG - Intronic
1138791200 16:59906096-59906118 AATAGCTGCATCCTTAAAGGAGG - Intergenic
1139035327 16:62938978-62939000 TAATGCTGCCTCCTTAATGCTGG + Intergenic
1139866636 16:70066936-70066958 GATTCCTCCCACCTTAATGTGGG + Intergenic
1140719240 16:77756094-77756116 AATAGTTGCCTACTCAATGTGGG - Intergenic
1140835995 16:78794255-78794277 ATTTGCTGCTTCCTTGATCTTGG + Intronic
1141782874 16:86176107-86176129 AAATTCTGCCTTCTTAATGTGGG + Intergenic
1144156174 17:12505926-12505948 AATTGACTCCTCCTTAATATTGG - Intergenic
1147001012 17:37362150-37362172 AACTGCTGACACCTTAATCTTGG + Intronic
1147496325 17:40919664-40919686 TATTGCCACCTCCTTTATGTGGG + Intergenic
1148384878 17:47227204-47227226 ATTTGCTGCCTCCATGGTGTTGG + Intergenic
1151028769 17:70710811-70710833 TATTGCTGGCTCCTAAATATTGG - Intergenic
1153330208 18:3866167-3866189 AATTGCTGTCTTTTTAATGAAGG + Intronic
1153844265 18:9034165-9034187 AAATGCTGGTTCCTTAATTTTGG + Intergenic
1155569650 18:27178169-27178191 AATTGCTGCATCCTCTTTGTCGG + Intronic
1156970816 18:43152168-43152190 TATTGCTGCATCCTCAGTGTAGG + Intergenic
1157332425 18:46713574-46713596 ATTTGCTGCCATCTGAATGTGGG - Intronic
1157478180 18:48036513-48036535 ATTTCCTCCCTCCTTGATGTTGG - Intronic
1158543710 18:58378570-58378592 ACTTGCTGCCTCCCTGCTGTCGG + Intronic
1159510650 18:69394787-69394809 AATAGTTACCTCCTCAATGTGGG - Intergenic
1159537907 18:69738103-69738125 AGTTGCAGCCTCTGTAATGTCGG + Intronic
1164785501 19:30927285-30927307 AATTTCTCCCTCCTTAGTCTAGG + Intergenic
1165604990 19:37094296-37094318 ACTTTCTCCCTCCTTAATGAGGG + Intronic
926132680 2:10314398-10314420 AATCTCAGCCTCCTTAATATAGG - Intronic
926560077 2:14407107-14407129 AATTGTTGCCTCCTTGATAATGG - Intergenic
926588276 2:14713129-14713151 AATTGCTGCCTCCGTTATCAGGG + Intergenic
926717556 2:15937126-15937148 AATTGCTGGCACCTTGATATTGG - Intergenic
930369977 2:50489921-50489943 ACTTCCCGCCTCCTTAAGGTAGG + Intronic
935302603 2:101706321-101706343 ACTTGCTGCCTCCCTTAAGTGGG + Intronic
935418729 2:102844883-102844905 AGTTTCTGCCTCTTTAAAGTAGG - Intergenic
936950849 2:117975949-117975971 AACTGCTGCCTCCTCAATCATGG + Intronic
938575657 2:132601083-132601105 AATTCCTGCCTCTTCAATTTTGG - Intronic
940376165 2:152961462-152961484 AAGTTCTGCCTCATTATTGTGGG - Intergenic
943755569 2:191553556-191553578 AATTGCTGCATTCTCAATCTTGG + Intergenic
946151036 2:217770831-217770853 AATTGCTTCCTCCTCCATGATGG - Intergenic
1168975261 20:1961101-1961123 AATTTCTGCCTCTTTAATTTGGG - Intergenic
1170657272 20:18299861-18299883 AATTTCTGCCTCAGTAATGAAGG - Intronic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1172608018 20:36228372-36228394 AATTGCTTCCTCCGTAAAATAGG - Intronic
1172800833 20:37574929-37574951 AATGACTGACTCCTTAATGGCGG - Intergenic
1177793272 21:25743500-25743522 AATTACTGCCTCCTTCACATAGG - Intronic
1177879701 21:26677779-26677801 AATTTCTGCCTCAATAATTTTGG + Intergenic
1178716328 21:34967899-34967921 TTTTGCAGCCTCCTTAATGTAGG + Intronic
1179269494 21:39839784-39839806 AAGTGCGGCCTCCTAAATGTGGG - Intergenic
1184578257 22:45392590-45392612 ACTTTCTGACTCCTAAATGTTGG - Intronic
949310873 3:2696557-2696579 ACTTGCTGGCTCCTTGATCTTGG + Intronic
953009865 3:39014807-39014829 AAATGCTGCCCACTTAATGATGG + Intergenic
955520134 3:59767604-59767626 AATTATTCCATCCTTAATGTTGG - Intronic
955608223 3:60729815-60729837 AAATGCTGCCTCCATTATATAGG - Intronic
957177915 3:76836221-76836243 GATTACTACTTCCTTAATGTAGG + Intronic
959130888 3:102354683-102354705 AATTGCTGCCCCCTCCATGATGG - Intronic
960169319 3:114439846-114439868 AATTGCTACATCCTTGATTTAGG + Intronic
960528375 3:118736238-118736260 AATTGCTGCCCCCTCAATGATGG + Intergenic
961127670 3:124435138-124435160 CATTGCTGCCTCACTAATGTTGG - Intronic
962204332 3:133422721-133422743 AACTGCTGCTTCATTAATGTTGG - Intronic
962258188 3:133886329-133886351 ATTTGTTGCCTGCTTATTGTGGG + Intronic
962351879 3:134662344-134662366 ATTTGCTGCCACCTTCATCTTGG + Intronic
962452954 3:135536869-135536891 ACTTGCAGCCTCCTTAATCCAGG + Intergenic
963292637 3:143507798-143507820 ATCTGCAGCCACCTTAATGTTGG - Intronic
964669216 3:159206988-159207010 ATTTGCTGACTCCCTAATCTAGG + Intronic
965529911 3:169761007-169761029 GATTGCTGCCTCCTTAAAAAGGG + Intergenic
965647899 3:170903113-170903135 AATTGCTGCCTGTTTCATGATGG - Intronic
966147271 3:176826303-176826325 AATTGCTGCCGCCATGATTTTGG - Intergenic
967240871 3:187438380-187438402 TACTGCTGCCTTCTAAATGTTGG - Intergenic
969139528 4:5056345-5056367 AATTGCAAGCTCCTTAAGGTAGG + Intronic
969150441 4:5164581-5164603 CCATGCTGCCACCTTAATGTGGG - Intronic
970419191 4:15889428-15889450 AAATTCTGTCTCCTTAATGAAGG - Intergenic
975312715 4:72920363-72920385 AAATGCTGGCTCCTTAATTTTGG + Intergenic
975648581 4:76569381-76569403 AACTGCTGCCTGCTTTATGAAGG + Intronic
977334320 4:95677054-95677076 AATTGCTCCATCCTTATTGTAGG - Intergenic
979124400 4:116949109-116949131 AATTCCTGCCTCTTTTTTGTGGG + Intergenic
982329419 4:154164576-154164598 AACTGCTGGCACCTTAATCTTGG + Intergenic
982371842 4:154642245-154642267 AATTGCTCCATCTTTAAAGTAGG - Intronic
982423265 4:155223264-155223286 AATTTCTGCCTCCTAAATTAAGG - Intergenic
983465795 4:168087829-168087851 AATTGCTGCCTCTCTTATTTAGG - Intergenic
983589189 4:169389190-169389212 AAATTCTGCCTCCTTGATTTAGG + Intergenic
984408996 4:179371153-179371175 AATCACTTCCTCCTGAATGTGGG - Intergenic
984836200 4:184024035-184024057 ATTTGCTGCCCCGTTAATGATGG + Intergenic
984925165 4:184800125-184800147 CATTGCTGCATACTTATTGTGGG + Intronic
989609603 5:43278438-43278460 TTTTGCTGCCTCCTTAATTTTGG + Intronic
990449091 5:55918710-55918732 AATTGCTGCCTCGTTACTGTGGG + Intronic
991405621 5:66298501-66298523 TATTTCTGCTTCCTTCATGTTGG + Intergenic
992000919 5:72435730-72435752 ATTTGCTACCTCCTTAATCCAGG + Intergenic
992966198 5:82003334-82003356 AAATTCTGCCTCCTTTTTGTGGG - Intronic
998767701 5:145506639-145506661 ATTTCCTGCCCCATTAATGTTGG - Intronic
999423582 5:151466602-151466624 AGTTTCTGTGTCCTTAATGTGGG + Intronic
999940218 5:156534255-156534277 CATTGCTGACTGCATAATGTGGG - Intronic
1000308365 5:160017313-160017335 AATTGCTGGCACCTTGATCTTGG - Intronic
1001522108 5:172402253-172402275 AATTCCTGCCTCATAAATTTTGG + Intronic
1003124435 6:3344809-3344831 ACCTGCTGCCTCCTTAAAATGGG + Intronic
1007238572 6:40408920-40408942 AAATGCTGGCACCTTAATCTTGG - Intronic
1010484995 6:76400097-76400119 CATTGCTTTCTCCTTTATGTTGG + Intergenic
1010687014 6:78865165-78865187 AACTGCTGACACCTTAATCTTGG + Intergenic
1011555961 6:88571820-88571842 TTTTGCTGCCTCCTTAAAGTGGG + Intergenic
1011842964 6:91525188-91525210 AATTGCTTCCTCTATAAAGTAGG - Intergenic
1015661266 6:135576355-135576377 AATTTCTGCCTCTTTTAAGTAGG - Intergenic
1022837956 7:34134902-34134924 AATTGCTACTTCCTTAAAGGAGG + Intronic
1023305041 7:38817218-38817240 AAATGCTGCCTCTTTTTTGTGGG + Intronic
1026207732 7:68272754-68272776 AATTGCTGCCCCTTTCATGATGG - Intergenic
1027794983 7:82681006-82681028 AATTGCTACATCCTTTCTGTAGG + Intergenic
1028781966 7:94747398-94747420 AATTGAGACCTCCTTAATTTTGG - Intergenic
1030069606 7:105687558-105687580 ACTTGCTGGCACCTTAATCTTGG + Intronic
1030356716 7:108551466-108551488 AAATGCTGGCGCCTTAATTTTGG + Intronic
1030899372 7:115103541-115103563 ACTGGCTGCTTTCTTAATGTTGG + Intergenic
1033868966 7:145726084-145726106 AATTTCTGACTTCTAAATGTTGG - Intergenic
1035556811 8:573208-573230 CACGGCTGCATCCTTAATGTTGG - Intergenic
1036423123 8:8616531-8616553 CATTGCAGCCTCCTTACTTTTGG + Intergenic
1037621464 8:20567053-20567075 AATTGCTGGCTCCCTGCTGTGGG - Intergenic
1037736974 8:21575601-21575623 ACTGGCTGCATACTTAATGTTGG + Intergenic
1038918726 8:32057481-32057503 AATTGCCACCTCATTAATATGGG + Intronic
1041835458 8:62208288-62208310 AATTTCTGCCTCTTTTGTGTTGG - Intergenic
1043627960 8:82288133-82288155 AGTTGCTACCTCCTTGATGTAGG + Intergenic
1043684778 8:83071645-83071667 AATTGCTGCCTAATAAATTTTGG - Intergenic
1044202870 8:89457197-89457219 AATTTCTTCATCTTTAATGTGGG - Intergenic
1044665838 8:94633560-94633582 AATTCCTCCCTCCTTACTGCTGG - Intergenic
1045735847 8:105295843-105295865 AAATGCTGCTTTCTTTATGTGGG + Intronic
1045751793 8:105494018-105494040 CCTTGAAGCCTCCTTAATGTGGG + Intronic
1049285541 8:141773216-141773238 AAATGCTGCCTCCTGGATGTGGG - Intergenic
1050074283 9:1847418-1847440 GATTGCTGTTTTCTTAATGTGGG - Intergenic
1050158242 9:2690629-2690651 CATTGCTGACTCCTGAATGTGGG - Intergenic
1050358491 9:4805048-4805070 GGTGGCTGCCTCATTAATGTGGG + Intronic
1051468071 9:17403525-17403547 AATTGATGCCTCCTCCATGATGG - Intronic
1053127301 9:35592616-35592638 CATTGCTGTCTCCTTAGGGTTGG - Intergenic
1056706199 9:88954475-88954497 CATTGCTGACTCCTTGATTTTGG - Intergenic
1056831236 9:89919008-89919030 AGTTTCTCCCTCCTTAACGTGGG + Intergenic
1056855700 9:90127832-90127854 ATTTGCTGCCTGGTTAGTGTTGG + Intergenic
1058459747 9:105172035-105172057 AACTGCTGCCTCTTTAGTCTGGG - Intergenic
1059797807 9:117718247-117718269 AATTGCTTCATGCTTAAAGTTGG + Intergenic
1186265298 X:7826006-7826028 AAATGCTGCCCTCTTCATGTGGG - Intergenic
1189602370 X:42640731-42640753 AATTTCTGCTTCCTCCATGTTGG - Intergenic
1191708775 X:64124487-64124509 GATTGCTTCTTCCATAATGTTGG + Intergenic
1192338852 X:70245161-70245183 ACTTGCTGGCACCTTAATCTTGG - Intergenic
1192500762 X:71650233-71650255 AATTGCTGGCACCTTGATCTTGG - Intergenic
1193371789 X:80707503-80707525 AATTGCTGGCTCTTTGTTGTAGG - Exonic
1194240335 X:91436757-91436779 AGTTGGTGCCTCCTTAGTTTGGG + Exonic
1194344324 X:92744498-92744520 AACTGTTGACTCCTTAATCTTGG - Intergenic
1197517881 X:127458714-127458736 AAATGTTGCCTTCTTAATGAAGG - Intergenic
1199554050 X:149087308-149087330 AATTTCTGCTTCCTTCATGATGG - Intergenic
1200652671 Y:5861139-5861161 AACTGTTGACTCCTTAATCTTGG - Intergenic