ID: 1135003854

View in Genome Browser
Species Human (GRCh38)
Location 16:18801322-18801344
Sequence GAGAAGGGCCGGGCCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 343}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135003839_1135003854 19 Left 1135003839 16:18801280-18801302 CCCAAGAAGCCCGAGGGCCAGGC 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG 0: 1
1: 0
2: 0
3: 32
4: 343
1135003842_1135003854 9 Left 1135003842 16:18801290-18801312 CCGAGGGCCAGGCATCGTCGCCT 0: 1
1: 0
2: 1
3: 11
4: 144
Right 1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG 0: 1
1: 0
2: 0
3: 32
4: 343
1135003835_1135003854 29 Left 1135003835 16:18801270-18801292 CCAGGAGTCACCCAAGAAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG 0: 1
1: 0
2: 0
3: 32
4: 343
1135003834_1135003854 30 Left 1135003834 16:18801269-18801291 CCCAGGAGTCACCCAAGAAGCCC 0: 1
1: 0
2: 2
3: 16
4: 174
Right 1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG 0: 1
1: 0
2: 0
3: 32
4: 343
1135003843_1135003854 2 Left 1135003843 16:18801297-18801319 CCAGGCATCGTCGCCTGCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 162
Right 1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG 0: 1
1: 0
2: 0
3: 32
4: 343
1135003840_1135003854 18 Left 1135003840 16:18801281-18801303 CCAAGAAGCCCGAGGGCCAGGCA 0: 1
1: 0
2: 4
3: 21
4: 232
Right 1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG 0: 1
1: 0
2: 0
3: 32
4: 343
1135003841_1135003854 10 Left 1135003841 16:18801289-18801311 CCCGAGGGCCAGGCATCGTCGCC 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG 0: 1
1: 0
2: 0
3: 32
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135003854 Original CRISPR GAGAAGGGCCGGGCCCGCGG CGG Intronic
900143822 1:1149619-1149641 GAGGAGGGCAGGTCCCGTGGTGG + Intergenic
900287830 1:1909981-1910003 GAGAAAGGGCAGGCCGGCGGAGG - Intergenic
901007714 1:6179876-6179898 GAGACGGGCCGGGCCCAGGGCGG - Intronic
901081494 1:6586493-6586515 GAGAAGGGCCTGGTGTGCGGTGG + Intronic
901373181 1:8817713-8817735 GAGGTGGGCCGGGCCCGAGCGGG - Intergenic
901680960 1:10912653-10912675 GGGCAGGGCCAGGCCGGCGGAGG - Intergenic
902079477 1:13811484-13811506 GACAGGGGCCGGGCCTGGGGAGG + Intronic
902193099 1:14777509-14777531 GAGGAGGGCCGGGCCCTGTGGGG - Intronic
902396379 1:16134288-16134310 GCGAAGTGCCTGGCACGCGGCGG - Intronic
902619912 1:17644739-17644761 AAGCAGGGCTGGGCCCGCGGTGG + Intronic
903724674 1:25431432-25431454 TGGAAGCGCCGGGCCCGCCGGGG + Intronic
904094661 1:27967410-27967432 GAGAAGGGCTGGGCCCTGGAGGG + Exonic
904169484 1:28581629-28581651 GAGAAGGGCGCGGCCCCCGCGGG + Intergenic
905212811 1:36385967-36385989 GCGGAGGGCGGGGCCCGGGGGGG - Intergenic
906720016 1:47997477-47997499 GCGAGGGGCCGGGGCCGCGCCGG + Intergenic
912879089 1:113390865-113390887 GGGAACGGCCGGGCCCCCAGCGG + Intronic
913109057 1:115641848-115641870 CAGGTGGGCCGGCCCCGCGGCGG + Intergenic
913131188 1:115839270-115839292 GAGAAGGGAAGGGCCCGGGGCGG + Exonic
913968102 1:143393377-143393399 GGGAAGGGCTGGGGCCGCCGCGG + Intergenic
914062483 1:144218967-144218989 GGGAAGGGCTGGGGCCGCCGCGG + Intergenic
915167865 1:153958547-153958569 GAGCCGGGCCGAGGCCGCGGCGG - Exonic
915558821 1:156674931-156674953 GAGAGGGGCTGGGCCCGTGTGGG - Intronic
915932798 1:160070281-160070303 GAGGGGGGCCGGGCAGGCGGGGG + Intergenic
917846660 1:179025933-179025955 GGGAATGGCCGGGCCGGGGGTGG + Exonic
918023611 1:180720107-180720129 GAGCAGGGCCGGGGGCGTGGGGG + Intronic
920021322 1:202958426-202958448 CAGCAGGGCGGGGCCCGGGGCGG - Intronic
921350572 1:214230348-214230370 GAAAAGGGCCAGGCACCCGGAGG + Intergenic
922899213 1:229123283-229123305 GAGAAGGTCCGGGCCAGCTCAGG - Intergenic
923126786 1:231040319-231040341 GAGAGGGGGCGGGGCCGGGGGGG - Intergenic
923429304 1:233905231-233905253 GGGAAGGGCGGCGCGCGCGGTGG + Intronic
1063657796 10:8009224-8009246 CAGCAGGGCAGGGCCCGCGGCGG - Exonic
1063664538 10:8053578-8053600 GAGAGGGGCGGGGCGAGCGGGGG - Intergenic
1064241271 10:13631781-13631803 GAGAAGGGCCGGGGATGTGGTGG + Intronic
1069615342 10:69802990-69803012 GAGGAAGGCTGGGCGCGCGGAGG + Intronic
1070168723 10:73916545-73916567 GAGAATGGCCTGGCCCTCTGAGG + Exonic
1070595565 10:77830548-77830570 GGGAAGGGCAGGGTCCTCGGAGG - Intronic
1070610168 10:77927095-77927117 GAGGAGGGACGGGCCGGCGGCGG - Intergenic
1070742776 10:78913576-78913598 GAGAGGGGCCTGGCAGGCGGAGG - Intergenic
1070962636 10:80509722-80509744 GAGGAGGGCCGGGCACGTGGGGG - Intronic
1071527416 10:86366522-86366544 GCGCAGGGGCGGGCGCGCGGGGG - Intergenic
1071997524 10:91162891-91162913 GAGGAGAGCAGAGCCCGCGGCGG - Intergenic
1072930675 10:99659486-99659508 AAGGAGGGCCCGGCCGGCGGCGG - Exonic
1073088678 10:100913269-100913291 GAGAAGGGGCCGGGTCGCGGGGG + Intronic
1076035521 10:127196192-127196214 CAGCAGGGCCGGGCCGGCAGCGG - Intronic
1076196161 10:128519815-128519837 GAGAAGGGCCAGCCCCTCGGGGG - Intergenic
1076462671 10:130657121-130657143 GAGAAGGGCCTGCACCGTGGGGG + Intergenic
1076746739 10:132518300-132518322 GAGCAGGGCCGGCCCAGGGGAGG - Intergenic
1076749943 10:132537610-132537632 GAGTGGGGCGGGGCCTGCGGGGG - Intergenic
1077048062 11:554949-554971 GAGTGGGGCCGGGACCGCGAGGG - Exonic
1077076887 11:706092-706114 GAGAGCGGGCGGGCGCGCGGGGG - Intronic
1077208225 11:1354267-1354289 GAGCAGGGCCGGGCACGTGCAGG - Intergenic
1077378351 11:2216010-2216032 GAGAAGGCCCGGGGCAGTGGGGG - Intergenic
1077416645 11:2427109-2427131 GTGAAGGGCCGGCCCCACTGGGG - Intergenic
1078222643 11:9364424-9364446 GAGAAGGCCCGGGACGCCGGCGG + Intergenic
1078364154 11:10692909-10692931 GAGCAGGGCCGGGCACGGGCCGG + Intronic
1083430797 11:62612780-62612802 GAGGGGGGGCGGGCCCGAGGGGG + Exonic
1083670988 11:64299860-64299882 GGGAAGGGCCGGGGCCAGGGAGG - Exonic
1083886592 11:65576227-65576249 GACCCGGGCCGGGCCAGCGGTGG + Exonic
1084028397 11:66466930-66466952 GGGATGGGCCCGGCCCGCGGCGG - Exonic
1084539560 11:69777312-69777334 GAGGAGGCCAGGGCCTGCGGAGG - Intergenic
1084544941 11:69810528-69810550 GGCAAGGGCCGGCCCCGCAGGGG - Exonic
1087761743 11:102110370-102110392 GAGAGGAGGCGGGGCCGCGGCGG + Intergenic
1090293885 11:125569540-125569562 GGGCAGGGCCGGAGCCGCGGCGG + Exonic
1090699170 11:129279211-129279233 GCGTCGGGCCCGGCCCGCGGAGG - Intronic
1091405035 12:203754-203776 GAGAGGGGCCGGGGCGGCGCTGG + Intronic
1092615630 12:10213245-10213267 GGGAGGGGAAGGGCCCGCGGGGG + Intronic
1093958848 12:25251107-25251129 GGGCCGGGCCGGGCCGGCGGGGG + Intergenic
1096228220 12:49882725-49882747 GGGCAGGGCCAGGCCCACGGAGG - Intronic
1096490588 12:52010626-52010648 GAGAAGGGCCGGTCCCCTGAAGG - Intronic
1096773307 12:53950004-53950026 GAGAAGGGCGGGGCGGGGGGAGG - Intergenic
1097107668 12:56634948-56634970 GAGCAGGGCCGGGCCGCAGGCGG + Intronic
1100963136 12:99984941-99984963 GGGAGGGGCCGGGCCGGCTGAGG + Intergenic
1102575924 12:113856114-113856136 GAGAAGGGCCAGTCCCGGAGAGG + Intronic
1103275672 12:119709925-119709947 CAGAAGGTCAGGGCCCACGGTGG + Intronic
1103488240 12:121296889-121296911 GCGCAGGGCCGAGCCGGCGGGGG - Intronic
1103852634 12:123943314-123943336 GAGCAGGCCCGGGCAGGCGGGGG - Intronic
1104918260 12:132277651-132277673 CAGCAGAGCCGGGGCCGCGGGGG - Intronic
1105413737 13:20192527-20192549 GAGTGGGGCCGGGCGCGCGCGGG - Intronic
1105943646 13:25171594-25171616 GAGACGAGCCGGAGCCGCGGCGG - Exonic
1107236115 13:38172947-38172969 GAAAAGGGCCTGGCCCACTGTGG - Intergenic
1108313886 13:49220098-49220120 GAGCAGGGCCGGGCCGGGGCGGG + Intergenic
1112051126 13:95644461-95644483 GACGCGGGCCGGGCCCGCGGAGG + Intronic
1112328112 13:98457276-98457298 GAGAAGAGCCAGGCGTGCGGAGG - Exonic
1113762544 13:112859598-112859620 GTGAAGGGTCGGGCCTGGGGAGG + Intronic
1114458251 14:22871348-22871370 GAGAAGGGGCGGGGCGGGGGCGG + Intergenic
1115120139 14:29928082-29928104 GGGAAGGGCCGCGCCTGCCGAGG - Intronic
1116945437 14:50831153-50831175 AGGAAGGGCCGGGCCCGCGCGGG + Intergenic
1118186509 14:63543028-63543050 TTGATGGGACGGGCCCGCGGGGG - Exonic
1118318779 14:64741459-64741481 GAGAAGGGCCTGGCCCGGCATGG + Exonic
1118627780 14:67674788-67674810 GAGAAGTGCCGGGTCCGGGTTGG + Exonic
1119802379 14:77457540-77457562 TAGAAGGGCTGGTCCAGCGGCGG - Exonic
1120697893 14:87664909-87664931 AATCAGGGCCGGGCGCGCGGTGG - Intergenic
1121238614 14:92412002-92412024 GAGAAGTCCGGGGCCCGCTGTGG + Intronic
1121473430 14:94174195-94174217 GGGAAGGGGCGGGGCCGAGGCGG + Intronic
1122300143 14:100726865-100726887 GAAAAGGGCGGCGCGCGCGGCGG + Exonic
1122425790 14:101604634-101604656 GAGAAGGGAGGGGCCCGGGTGGG + Intergenic
1124220466 15:27846349-27846371 GAGCAGGGCAGGGCCTGCTGAGG - Intronic
1124453868 15:29822548-29822570 GGGAGGGGGCGGGGCCGCGGCGG + Intronic
1124496716 15:30191824-30191846 GAGTAGGACTGAGCCCGCGGTGG - Intergenic
1124604838 15:31162276-31162298 GAGAAAGGCCGGGCTGGGGGCGG + Intergenic
1124746860 15:32346824-32346846 GAGTAGGACTGAGCCCGCGGTGG + Intergenic
1125834454 15:42737159-42737181 GGGAGGGGCGGGGCCGGCGGCGG + Intergenic
1126467693 15:48975939-48975961 GAGAAGGGCACAGCCCGGGGCGG - Intergenic
1127438991 15:58987534-58987556 GGGGAGGGCCGGGACCGAGGGGG + Intronic
1128119269 15:65133637-65133659 GAAAAGGGCCGGGCCGCTGGGGG + Exonic
1129026003 15:72574897-72574919 GAGATGGGCGGGGGCGGCGGGGG - Intronic
1129326045 15:74800749-74800771 GAGCTGGGCCGGGCCCCCTGGGG + Intronic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1131263523 15:90902640-90902662 GAGCCGGGCGGGGACCGCGGCGG + Intronic
1132558617 16:583556-583578 GTGAGGGCCCGGGCCCGCTGGGG - Exonic
1132570550 16:642197-642219 GCAAAGGGCTGCGCCCGCGGGGG - Exonic
1132629058 16:908006-908028 GAGAGGAGCCGGCCCCGCAGAGG - Intronic
1132843830 16:1990883-1990905 GAGGAGGGCGGTGCCCACGGTGG + Intronic
1132925966 16:2429304-2429326 GACATGGGCGGGGCCGGCGGCGG + Intergenic
1133325137 16:4937401-4937423 GAGGCGCGCCGGGCCCGAGGAGG - Intronic
1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG + Intronic
1136609422 16:31357142-31357164 GGGAGGAGCCGGGGCCGCGGGGG + Intronic
1136782852 16:32917878-32917900 GCAGAGGGCCGGTCCCGCGGTGG - Intergenic
1136886944 16:33935972-33935994 GCAGAGGGCCGGTCCCGCGGTGG + Intergenic
1137056624 16:35749255-35749277 GGGAAGGTCCCGGGCCGCGGTGG - Intergenic
1137616781 16:49853287-49853309 GAGAAGGGGCGGGGCGGGGGGGG + Intronic
1138023207 16:53503056-53503078 GACAAATGCCGGGCCCGTGGAGG + Intronic
1138327897 16:56191135-56191157 GAGTGGGGCCGGGCGCGCGCCGG - Intergenic
1138443754 16:57050433-57050455 GAGATGGGCCAGGCCCTTGGAGG + Intronic
1138619136 16:58197877-58197899 GCGCCAGGCCGGGCCCGCGGGGG + Exonic
1139426097 16:66880782-66880804 GTGAGGGGGCGGGTCCGCGGCGG + Intronic
1139484142 16:67246786-67246808 GAGGAGGGGCGGGCCCGAGGCGG - Intronic
1139544784 16:67645080-67645102 GGGAGGGGCCGGGCCGGGGGCGG + Exonic
1140518998 16:75566253-75566275 GTAAAGGGGCGGGGCCGCGGAGG - Intergenic
1141911932 16:87066342-87066364 GAGAAGGGCCGGCTCCGGGTAGG + Intergenic
1142132614 16:88437851-88437873 CAGAAGGCCCGGGCCCTCGAGGG + Exonic
1142191864 16:88721788-88721810 GAGGTGGGCCGAGGCCGCGGGGG - Exonic
1142257461 16:89021385-89021407 GAGAGGGGCAGGTCCCGCGTGGG - Intergenic
1203085500 16_KI270728v1_random:1181862-1181884 GCAGAGGGCCGGTCCCGCGGTGG - Intergenic
1143178370 17:4969184-4969206 GGGGAGGGCCGGGCCTGCGGCGG + Exonic
1143490201 17:7281667-7281689 GTGAAGGGCGTGGCCCGCGGGGG + Exonic
1143548539 17:7614653-7614675 GAGCCGGGCCGGCCCCACGGCGG + Exonic
1143762851 17:9117313-9117335 GGGAAGGGCCCGGCCTGGGGCGG + Intronic
1144548041 17:16215627-16215649 GAGAGGCGCCCGGCCAGCGGAGG - Intronic
1145898229 17:28473307-28473329 AGGAAAGGCCGGGCCAGCGGAGG + Exonic
1145941158 17:28744066-28744088 GAGCGGGGCCAGGCACGCGGCGG - Exonic
1146357035 17:32142818-32142840 GAGAAGGGCCGGGGCTGCAAAGG - Intronic
1147743068 17:42679600-42679622 AAGAAAGGCGGGGCCGGCGGGGG + Exonic
1147823384 17:43255188-43255210 GAGAAGGGCCTGGCCACGGGGGG - Intergenic
1147824967 17:43264528-43264550 GAGAAGGGCCTGGCCACGGGGGG - Intergenic
1147828088 17:43282050-43282072 GAGAAGGGCCTGGCCACGGGGGG - Intergenic
1147829198 17:43288214-43288236 GAGAAGGGCCTGGCCACGGGGGG - Intergenic
1147923479 17:43932749-43932771 GAGGAGGGCTGGGGGCGCGGGGG + Intergenic
1147951944 17:44112352-44112374 GAGCAGGGGCAGGCCAGCGGTGG - Intronic
1148209373 17:45799020-45799042 GAGGAGGGCCAGGCCCGAGGCGG + Intronic
1148568370 17:48646960-48646982 GAGATGGGCCTGGCGCGCCGCGG + Intergenic
1148818239 17:50346017-50346039 GAGGCGGGCCGGGCGCGCGCCGG - Intergenic
1148823619 17:50376172-50376194 GAGAAGGGCTGGGCCGTCTGAGG + Exonic
1148865472 17:50626098-50626120 GAGTAGGCCCGGGCCAGGGGCGG - Exonic
1149293332 17:55238330-55238352 GCGCAGGGGCGGGTCCGCGGTGG - Intergenic
1150301792 17:64053288-64053310 GAGGTGGGCCAGGCCCGAGGTGG + Exonic
1151334858 17:73433927-73433949 GATGAGGGCCTGGCCCTCGGTGG - Intronic
1151580239 17:74973286-74973308 GAGAGGGGTCGGGACCGCGAGGG - Intergenic
1152433113 17:80260528-80260550 GGGCAGGGCGGGGCCGGCGGCGG + Intergenic
1152433126 17:80260558-80260580 GGGCAGGGCGGGGCCGGCGGCGG + Intergenic
1152433139 17:80260588-80260610 GGGCAGGGCGGGGCCGGCGGCGG + Intergenic
1152433152 17:80260618-80260640 GGGCAGGGCGGGGCCGGCGGCGG + Intergenic
1152433165 17:80260648-80260670 GGGCAGGGCGGGGCCGGCGGCGG + Intergenic
1152433178 17:80260678-80260700 GGGCAGGGCGGGGCCGGCGGCGG + Intergenic
1152433191 17:80260708-80260730 GGGCAGGGCGGGGCCGGCGGCGG + Intergenic
1152433204 17:80260738-80260760 GGGCAGGGCGGGGCCGGCGGCGG + Intergenic
1152433217 17:80260768-80260790 GGGCAGGGCGGGGCCGGCGGCGG + Intergenic
1152433230 17:80260798-80260820 GGGCAGGGCGGGGCCGGCGGCGG + Intergenic
1152552314 17:81035698-81035720 GGGCAGGGCCGGGGCGGCGGGGG + Intronic
1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG + Exonic
1152683928 17:81684362-81684384 CCGAATGCCCGGGCCCGCGGAGG - Intronic
1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG + Intronic
1152811001 17:82382872-82382894 GGGAAGGGCAGGGCCTGGGGTGG - Intergenic
1153900649 18:9614588-9614610 GAGGAGGGCCGGGCTGGCGGGGG + Intronic
1153935104 18:9914219-9914241 GAGCGGGGGCGCGCCCGCGGCGG - Exonic
1155910413 18:31498434-31498456 GAAAAGGGCCGGGCAGGCTGCGG + Intronic
1156350735 18:36298650-36298672 GAGGAGGGGCGGGGGCGCGGAGG + Intronic
1158893740 18:61894765-61894787 GAAGGGGGCCGGGGCCGCGGTGG + Intergenic
1160793584 19:933815-933837 GAGAATGGCCAGGGCAGCGGCGG + Intronic
1160869246 19:1269503-1269525 GGGAGGGGGCGGGCCCGGGGTGG + Intronic
1160875542 19:1294815-1294837 GAGAAGGACCGGGGCAGCGTGGG - Intronic
1161063810 19:2227962-2227984 GAGGACGGGCGGCCCCGCGGGGG - Intronic
1161095002 19:2385155-2385177 GCGGAGGGCGGGGCTCGCGGGGG + Intergenic
1161682447 19:5687002-5687024 GGGGCGGGCCGGGGCCGCGGAGG - Intronic
1162363149 19:10231363-10231385 GAGGAGGGCGGGGCGAGCGGGGG - Intergenic
1162937088 19:13986755-13986777 GGGAAGTGCGGGGCCCGGGGAGG - Intronic
1162940354 19:14005803-14005825 GCGAAGGGGCGGGCCTGGGGAGG - Intronic
1163612774 19:18309731-18309753 GCCAAGGGCCGCGGCCGCGGAGG - Exonic
1163672335 19:18636589-18636611 GACAAGGGTCCGGCCTGCGGAGG - Intergenic
1165079251 19:33298346-33298368 GAGGAGGGCGAGGCCCCCGGGGG - Intergenic
1165080231 19:33302529-33302551 GCGAATGGCCCGGCCCGCGCCGG + Exonic
1165420020 19:35717985-35718007 GAGAGGGGCCGGGGAGGCGGGGG - Intergenic
1165421021 19:35721954-35721976 GAGAAGGGCCAGGTCTGGGGAGG - Intronic
1165639405 19:37371229-37371251 GAGTGGGGCCGGGCCCCGGGCGG + Intronic
1165772721 19:38388268-38388290 ACGAAGGGGCGGGCCCACGGTGG - Intergenic
1166094192 19:40529453-40529475 GAGAGGGGCGGGGCGGGCGGTGG + Intronic
1167166847 19:47804416-47804438 GAGAAGGGCTGGGCCTGTGCGGG - Intronic
1167174989 19:47859348-47859370 GAGAAGGGCTGGGCCTGTGCGGG + Intergenic
1167429066 19:49443846-49443868 GAGAAGGGCCGCGCACTCCGAGG + Intergenic
1168346866 19:55654217-55654239 AAAAAGGGCCGGCCTCGCGGAGG - Intronic
925146090 2:1584392-1584414 CAGCAGGGCAGCGCCCGCGGTGG - Intergenic
925609787 2:5693136-5693158 GAGAAGAGCGCGGCCGGCGGCGG + Exonic
927179433 2:20434114-20434136 GACAAGGGCCTGGCCTGTGGGGG + Intergenic
927713947 2:25341197-25341219 GAGGAGGGCCGGGCGCCGGGGGG + Intronic
928167745 2:28982867-28982889 GATAAGGACAGGGCCCACGGGGG - Intronic
928512000 2:32010744-32010766 GAGCGGGGCGGGGCCGGCGGCGG - Intronic
929452941 2:42048503-42048525 GACAGGGGCCGGGCCCAAGGGGG - Exonic
931602292 2:64017049-64017071 GTGATGGGCCGGGGCCGGGGCGG + Intronic
932619100 2:73255469-73255491 GAGAAGGGCCAGGCCCCCAGGGG + Exonic
934763447 2:96868530-96868552 GAGAAGGGCCGGGAGCGAAGGGG + Intronic
934993263 2:98936141-98936163 GCGCAGGGCCGGGCCGGCCGCGG - Exonic
937276192 2:120685615-120685637 GAGTAGGGCCTGGCCCATGGAGG + Intergenic
937472114 2:122183130-122183152 GAGAAGAGCCGGGCCAGTGGTGG - Intergenic
939698917 2:145364073-145364095 GAGAAGGGCTTGGGCCGGGGAGG + Intergenic
943571514 2:189580785-189580807 GAGCTGGGCCCGGCCCACGGCGG - Exonic
943669893 2:190649167-190649189 AAGAAGCGGCGGGCCCGAGGTGG + Intronic
946311331 2:218883915-218883937 GGGTAGGAGCGGGCCCGCGGCGG - Intronic
947593159 2:231396220-231396242 GAGAGGGGCCGGGCGGGCGGCGG - Intronic
947792501 2:232876191-232876213 GAGAAGGGCCGGCCAGGCGGGGG + Intronic
948159375 2:235811728-235811750 GAGCTGGGCCGGGCCGGGGGCGG - Intronic
948205204 2:236159781-236159803 AGGCAGGGCCGGGCCCGGGGTGG - Intergenic
948479279 2:238240044-238240066 TAAAAGGGGCGGGACCGCGGCGG - Exonic
948993221 2:241564953-241564975 GAGCAGGGCCTGGCCTGAGGTGG + Intronic
1170150077 20:13220130-13220152 GGGAAGGGCTGGGCCGGCGCTGG + Intergenic
1170708479 20:18767369-18767391 GAGCAGGGCCTGGACCGCAGAGG + Intergenic
1171430564 20:25081289-25081311 GGGAAGGCCCGGGCCTGTGGTGG - Intronic
1172901331 20:38337013-38337035 GAGAAAGGCAGGGCCAGTGGGGG - Intronic
1173418531 20:42880098-42880120 GAGGAGGGGCAGGCCCGGGGGGG + Intronic
1175215748 20:57391142-57391164 GCAACCGGCCGGGCCCGCGGGGG + Intergenic
1175311025 20:58011647-58011669 AAGAAGGGCCGGGGCCCCTGAGG + Intergenic
1175927050 20:62476069-62476091 AAGAAGGGGCGGGCGCGGGGAGG - Intergenic
1176377239 21:6092712-6092734 GAGAGGGGCCGGGCCTGTGGCGG - Intergenic
1176550016 21:8217003-8217025 GAGAAGGGTCGGGGCGGCAGGGG + Intergenic
1176568942 21:8400037-8400059 GAGAAGGGTCGGGGCGGCAGGGG + Intergenic
1176576856 21:8444272-8444294 GAGAAGGGTCGGGGCGGCAGGGG + Intergenic
1176724561 21:10419968-10419990 AAAAAAGGCCGGGCACGCGGTGG + Intergenic
1178494105 21:33072133-33072155 GTCAAGGGCCCGGCCCGCTGAGG - Exonic
1178992485 21:37367211-37367233 GAGAAGCGCCGGGGCCCGGGCGG - Intronic
1179746236 21:43445532-43445554 GAGAGGGGCCGGGCCTGTGGCGG + Intergenic
1179810062 21:43864874-43864896 GGGGCGGGCCGGGACCGCGGGGG - Intergenic
1180064270 21:45404998-45405020 GAGCAGGGCAAGGCCCGGGGAGG - Intergenic
1180958270 22:19750808-19750830 GAGGAGGGCCGGGGCCGGGAGGG - Intergenic
1180988127 22:19917540-19917562 GAGAAAGGCTGGGCCAGAGGCGG + Intronic
1181045643 22:20213069-20213091 GAGGAGGGCCGGGCTCGCCAGGG - Intergenic
1181652911 22:24270819-24270841 GCCAAGGGCGGGGCCCGCGAGGG + Exonic
1183071520 22:35399867-35399889 GCGGAGGGGCGGGCGCGCGGAGG - Intergenic
1183093961 22:35541216-35541238 GGGCAGGGCAGGGCCGGCGGCGG + Exonic
1183209595 22:36442740-36442762 GAGAAGGGAGGTGCCCACGGTGG + Intergenic
1183546184 22:38455741-38455763 GAGAAGGACAGGGGCCGCGAGGG - Intergenic
1183659127 22:39208123-39208145 GAGAAGGGCGGGGCAGGCTGGGG - Intergenic
1183724138 22:39579023-39579045 CAGAAGGGCAGGGCCCACGTAGG - Intronic
1183942009 22:41301413-41301435 GAGAAGGGCGGGGGGCGTGGGGG - Intergenic
1184138353 22:42562522-42562544 GAGAAGGGGAGGGCTCGTGGAGG + Intronic
1184250495 22:43257564-43257586 GAGACGGGCTGGGGCAGCGGCGG + Intronic
1184851679 22:47124751-47124773 GAGCAGTGAGGGGCCCGCGGGGG + Intronic
1185027570 22:48424511-48424533 AAGATGGGCCGGGACCCCGGGGG + Intergenic
1203254906 22_KI270733v1_random:133329-133351 GAGAAGGGTCGGGGCGGCAGGGG + Intergenic
1203262962 22_KI270733v1_random:178408-178430 GAGAAGGGTCGGGGCGGCAGGGG + Intergenic
950453529 3:13079126-13079148 GAGCAGGGCCGGGCCTGTGGAGG + Intergenic
950658185 3:14450275-14450297 CAGAGGGACCGGGCCCTCGGGGG + Intronic
950730084 3:14948572-14948594 GAGTGGGGCCGGGTCGGCGGGGG + Intronic
950940381 3:16885086-16885108 GCCGAGGGCCGGGCCCGGGGAGG - Intronic
951611317 3:24495084-24495106 GGGGCGGGCCGGGCACGCGGGGG - Intronic
952354404 3:32570877-32570899 GAGCGGGGCGGGGCCTGCGGGGG + Intergenic
953989901 3:47475929-47475951 GTGAAGGGGCGGGCACCCGGCGG - Exonic
954139979 3:48599863-48599885 GAGATGGGCGGGGCCCATGGAGG - Intronic
956406389 3:68932576-68932598 AGGAGGGGCCGGGCCCGCCGCGG + Exonic
961469131 3:127100584-127100606 GGGATGGGGCGGGCCTGCGGAGG - Intergenic
961599747 3:128051779-128051801 GAGAAGGGCCGGGGCAGCTCGGG - Intronic
961650651 3:128415245-128415267 GAGAAGAGACGGGCCCAGGGAGG + Intergenic
961929383 3:130517116-130517138 GGGAAGGGTCGGGCCCGGGGCGG + Intergenic
963105683 3:141645219-141645241 GACAAGGGCCGGCCCCAGGGAGG + Intergenic
966596239 3:181726669-181726691 CTGAAAGGCAGGGCCCGCGGCGG - Intergenic
966886467 3:184380216-184380238 GCGGAGGGCCGGGCCGGGGGCGG - Exonic
968066631 3:195762717-195762739 GTGCAGGGCCGGGCGCGTGGCGG - Intronic
968066644 3:195762761-195762783 GTGCAGGGCCGGGCGCGTGGCGG - Intronic
968779698 4:2571112-2571134 AGGAAGGGCTGGGGCCGCGGAGG - Intronic
969475876 4:7422270-7422292 GAGAACGGCATGGCCCGAGGAGG - Intronic
973758921 4:54100008-54100030 GAGGAGGGGCGGGCGCGCGGCGG - Intronic
976297307 4:83485101-83485123 GACGAGGGCGGGGCGCGCGGAGG + Exonic
977908260 4:102501567-102501589 GGGAAGCGCAGGGCGCGCGGTGG - Exonic
981615381 4:146639054-146639076 GAGAAGTGCCGGGCCAGCCGGGG - Exonic
983577184 4:169271514-169271536 GGGAGGGGCTGGGTCCGCGGAGG + Intergenic
983904409 4:173169143-173169165 GCGAGGGGGCGGGCCGGCGGCGG - Intronic
984811286 4:183798066-183798088 GGGACGGGACGGGCGCGCGGCGG - Intergenic
985073642 4:186191770-186191792 GGGAAAGTGCGGGCCCGCGGGGG - Exonic
985472278 5:53598-53620 GAGAAGGGCGGGGGCGGAGGGGG + Intergenic
985653348 5:1117187-1117209 GAGCTGGGCCTGGCCTGCGGGGG + Intergenic
988999512 5:36745507-36745529 GAGAGGGGCCGGGCCCTTGTGGG + Intergenic
990356147 5:54968250-54968272 GGGAAGGGCTGGGCCATCGGGGG - Intergenic
992796096 5:80256133-80256155 GGGAAGGGGCGGGCACGGGGCGG - Intergenic
997583100 5:135029338-135029360 GAGAAGGGTCAGGGCCGCTGCGG + Intronic
998157713 5:139795941-139795963 GTGAGAGGCCGGACCCGCGGCGG + Exonic
998566097 5:143217182-143217204 GAAAAGGGAGGGGCCCGTGGAGG + Intronic
999758605 5:154683124-154683146 GAAAGGGGCCCGGGCCGCGGTGG + Intergenic
1001506519 5:172284122-172284144 GAGAAGGGCGGGGCCACCGGAGG + Intergenic
1001617879 5:173056948-173056970 AGGAAGGGCCGGGGCCGCGGAGG + Intronic
1002532840 5:179858932-179858954 GCGCAGGGGCGGGGCCGCGGCGG - Intronic
1002713140 5:181207058-181207080 GAGGAGGGCAGGGGCCGCCGCGG - Intergenic
1003754084 6:9096455-9096477 GAGAAGTGCGGGGCCCCTGGGGG - Intergenic
1005851726 6:29827960-29827982 GGGAGGGGCCGGCCCGGCGGGGG + Intronic
1005931693 6:30489638-30489660 GAGAGGGGCCGGCCCGGCGGGGG + Intronic
1006081898 6:31572678-31572700 GAGCGGGGCGGGGCACGCGGCGG - Intronic
1006188348 6:32192672-32192694 GGGATGGGCGGGGCCCGTGGGGG - Exonic
1006562557 6:34926245-34926267 GAGAAGGGCAGGGCCTGCTGGGG + Intronic
1007908989 6:45494241-45494263 GAGGAGGGCCAGGCCTGTGGAGG - Intronic
1010378592 6:75202742-75202764 GAGCAGGGCCGCGCCCAGGGCGG + Exonic
1011275037 6:85622416-85622438 GAGAAGGGCCGGGGTTGGGGTGG - Intronic
1012410217 6:98947963-98947985 GAGGAGCGGCGGGCCCGGGGAGG + Intronic
1013272877 6:108559694-108559716 GCGGCGGGCCGGGCGCGCGGCGG - Intergenic
1014098113 6:117482334-117482356 TAGATGGGCTGAGCCCGCGGCGG - Intronic
1015149216 6:130019827-130019849 GAGGCGGCGCGGGCCCGCGGCGG + Intronic
1016340935 6:143060855-143060877 GGGAGGCGCCGGGCGCGCGGGGG - Exonic
1018013601 6:159693336-159693358 GCGCGGGGCGGGGCCCGCGGGGG - Intronic
1019010284 6:168839414-168839436 TAGAAGGCCCTGGCCCGCTGGGG + Intergenic
1019426092 7:977556-977578 AAGAAGGGCAGGCCCCGGGGTGG - Intergenic
1019472263 7:1227348-1227370 GAGAAGGGGCTGCCCGGCGGGGG - Intergenic
1019711319 7:2519503-2519525 GGGACGGGCCCGGCCCGCGCCGG - Intronic
1019726868 7:2607672-2607694 GAGAAAGGCAGGGCCTGCTGGGG - Intronic
1020049351 7:5071900-5071922 GAAGAGGGCCAGGCCCGCGTGGG + Intronic
1020383021 7:7566854-7566876 GGGAAGGGCGGGGCTCGCGCTGG + Exonic
1023773744 7:43583512-43583534 GATAAGTGCCGGCGCCGCGGCGG + Intronic
1023848712 7:44138897-44138919 GGGCAGGGCCAGGCCCACGGGGG - Exonic
1024267062 7:47614858-47614880 GAGAAGCTCCGGGCCCTCAGTGG + Intergenic
1025738956 7:64181636-64181658 GCGCCGGGCCGGCCCCGCGGTGG + Intronic
1027592574 7:80134796-80134818 GGGCAGGGGCGGGGCCGCGGCGG + Exonic
1028593988 7:92528539-92528561 GAGAGGGGGCGGGGCCGCAGGGG - Intergenic
1028773591 7:94655745-94655767 GAGCAGGGAGGGGCCCGCGGGGG + Intronic
1029133170 7:98349285-98349307 CAGAAGTGCCCGGCACGCGGTGG + Intronic
1029371859 7:100155379-100155401 GAGAGGGGCCGGGCCTCGGGTGG + Exonic
1029460816 7:100693368-100693390 GAGAAGGGCCTGGCCTGGGACGG + Intergenic
1029562003 7:101308931-101308953 GGGAAGGGCTGGGCCCCAGGCGG - Intergenic
1031483971 7:122306852-122306874 GAGAAGGGCAGAGCGCCCGGGGG + Intronic
1032021662 7:128409986-128410008 GAGGAGGGGCGGGGCCGCCGGGG + Exonic
1034129007 7:148698843-148698865 GAGGAGGGCCGGGCGGGCAGGGG + Intronic
1034224965 7:149474958-149474980 GTGAAGGGCCGGCCCCCGGGGGG + Exonic
1034423728 7:151002141-151002163 GAGGAGGGCAGGGCCTCCGGGGG + Intronic
1034449506 7:151129705-151129727 GACAAGGTCTGTGCCCGCGGTGG - Intronic
1034994582 7:155570007-155570029 GAGGAGGACAGGGCCCGCTGTGG - Intergenic
1038554120 8:28494558-28494580 GCGGGGGCCCGGGCCCGCGGTGG + Intronic
1039493586 8:37965330-37965352 GAAGAGGGCCGGGCGGGCGGCGG + Exonic
1041449776 8:57994580-57994602 GCGAAGGGCCCGGCTGGCGGCGG - Exonic
1045564368 8:103298804-103298826 GGGCAGGTCCGGGCTCGCGGCGG - Intronic
1048865726 8:138760269-138760291 CAGAAGGGCCGGGCCTGCCCTGG + Exonic
1049234973 8:141507912-141507934 GAGCAGGGCCAGGCCCACAGCGG - Intergenic
1049463655 8:142741408-142741430 GAGGAGGGCTGGGCCCTGGGTGG - Intronic
1049687294 8:143944081-143944103 GCCGAGGGCCGGACCCGCGGAGG - Intronic
1049774189 8:144397089-144397111 GGGAAGGGGCGGGGCCGTGGGGG + Intronic
1053001278 9:34578410-34578432 GAGAGGGGCCGGGACCGGAGCGG - Intronic
1053651926 9:40177615-40177637 GAGAAGAGGCGTCCCCGCGGCGG + Intergenic
1057130740 9:92652895-92652917 CAGAATGGCTGGGCCCACGGTGG + Intronic
1057705262 9:97391186-97391208 GTGAAGGCCCGGGCCGGCGCAGG - Intergenic
1058610408 9:106769885-106769907 GAGAAGGGCTGACCCAGCGGTGG + Intergenic
1060468631 9:123929844-123929866 GAGCCGGGCCGGGCGCGGGGCGG - Intronic
1060479994 9:124012223-124012245 GGGCGGGGCCGGGGCCGCGGTGG + Exonic
1061056432 9:128225225-128225247 GAGAGGGGCCGGGACAGCAGTGG - Intronic
1061384744 9:130282591-130282613 CAGAGGGGCCGGGGCCACGGGGG + Intergenic
1061394157 9:130334172-130334194 GAGATGGGCCTGGCCCCCTGCGG + Intronic
1061450606 9:130665122-130665144 GGGAAGGGAGGGGCCGGCGGGGG - Intronic
1061594285 9:131618940-131618962 CAGAAGGGCAGGGGCCGCGACGG + Intronic
1061895266 9:133643718-133643740 CAGAAGGGCCAGGCCTGAGGTGG + Intronic
1061990725 9:134157246-134157268 GGGAAGGCCCAGGCCCGCCGTGG - Intronic
1062016391 9:134293326-134293348 GAGAAGGGCAGGGCACGAGGTGG + Intergenic
1062180854 9:135190226-135190248 GACAAGGGCCTGGCCCACTGTGG + Intergenic
1062186512 9:135221332-135221354 GAGAATGGCCAGGGCCGTGGTGG + Intergenic
1062279335 9:135744962-135744984 GAGACGGGCCCGGCCCCCTGTGG + Intronic
1062499438 9:136845957-136845979 GAGAAGGGCCGCGCGGGCGAGGG + Exonic
1203787563 EBV:136467-136489 GATGAGGTCCTGGCCCGCGGCGG - Intergenic
1203471307 Un_GL000220v1:116474-116496 GAGAAGGGTCGGGGCGGCAGGGG + Intergenic
1203479128 Un_GL000220v1:160446-160468 GAGAAGGGTCGGGGCGGCAGGGG + Intergenic
1185778811 X:2828855-2828877 GAGAGGACCCGCGCCCGCGGGGG + Exonic
1186516107 X:10167041-10167063 GGGCAGGGCCGGGGCCGGGGAGG + Intronic
1189337135 X:40176776-40176798 GACAAGGGCCGGGCCGGGCGGGG - Intronic
1190055758 X:47180165-47180187 CAGAAGGGTCAGGCCCGGGGAGG - Intronic
1197941646 X:131795978-131796000 GCGAAGGGCTGCGCCCGCTGGGG + Intergenic
1199976534 X:152897898-152897920 GAGAAGGGGCGGGCGGGCGGAGG + Intergenic