ID: 1135004700

View in Genome Browser
Species Human (GRCh38)
Location 16:18809355-18809377
Sequence CACCATGGCCTGCAACCCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135004700_1135004706 10 Left 1135004700 16:18809355-18809377 CCCTGGGGTTGCAGGCCATGGTG 0: 1
1: 0
2: 0
3: 22
4: 275
Right 1135004706 16:18809388-18809410 CCCTGAGTGCAGCTGTCCTGCGG 0: 1
1: 0
2: 1
3: 47
4: 331
1135004700_1135004708 11 Left 1135004700 16:18809355-18809377 CCCTGGGGTTGCAGGCCATGGTG 0: 1
1: 0
2: 0
3: 22
4: 275
Right 1135004708 16:18809389-18809411 CCTGAGTGCAGCTGTCCTGCGGG 0: 1
1: 0
2: 1
3: 25
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135004700 Original CRISPR CACCATGGCCTGCAACCCCA GGG (reversed) Exonic
900396846 1:2456590-2456612 CCCCATGTCCCCCAACCCCAAGG - Intronic
900474063 1:2868149-2868171 CATCCCGGCCTGCAGCCCCAGGG + Intergenic
901795924 1:11679813-11679835 CACCATGCCCGGCCACCCCCGGG + Intronic
902165007 1:14563153-14563175 CACCAAGGCCTCCAACCATAGGG + Intergenic
902512655 1:16974772-16974794 CACCGCAGCCTGCAACCCCCAGG + Exonic
902534659 1:17112545-17112567 CAGCCTGTCATGCAACCCCATGG + Intronic
903781589 1:25823445-25823467 CACCCTGGCCAGCCACCCAAGGG - Intronic
904800804 1:33091996-33092018 CACCAGGGCCTGCTAGCCCACGG - Intronic
904804188 1:33119408-33119430 CCCCATGGTCTCCATCCCCATGG - Intronic
904813865 1:33181414-33181436 CGCCATGGCGTGCAGCCTCAAGG - Exonic
906358169 1:45126912-45126934 CACTATGGCCTGGAACTCCTGGG + Intronic
906612533 1:47213346-47213368 CACCATGGCCTGTGTCCCCATGG + Intergenic
907269476 1:53282436-53282458 CACCCTGCACTGCAGCCCCAAGG - Intronic
908639498 1:66206135-66206157 CACCATGGCCTGCCACTGCTAGG + Intronic
909475291 1:76074863-76074885 CGCCATGGCCTGCATCCTGAAGG + Exonic
909675710 1:78237144-78237166 CACAATGGCTTGCAACCCAATGG + Intergenic
911793875 1:102053238-102053260 CACCATGGCCTGGACTTCCAGGG - Intergenic
911857460 1:102898142-102898164 CATCTTGGCCTGCAGCTCCAGGG + Exonic
912121162 1:106473575-106473597 CACCACTGCCTGCAACACCATGG + Intergenic
912490372 1:110059492-110059514 CCCCATGGGCTGGGACCCCAGGG - Intronic
915911749 1:159919745-159919767 CACCATGGCCTTCAAGCAGATGG - Exonic
916724463 1:167510428-167510450 CACACTGACCTGCAACCCCTGGG + Intronic
917301120 1:173575042-173575064 CACTATGGCCTCCACCTCCAGGG - Intronic
918110638 1:181452488-181452510 CCCCATCACCTGCAAGCCCAAGG - Intronic
920226130 1:204440516-204440538 CAGCTTGTCCTGCAATCCCATGG + Intronic
922101825 1:222483339-222483361 CACCATGCCCAGCAATCACAAGG - Intergenic
922262907 1:223958460-223958482 CACCATGCCCAGCAATCACAAGG - Intergenic
922872181 1:228911710-228911732 TACCTTGGCCTGGGACCCCAGGG - Intergenic
923045654 1:230353992-230354014 CAGCAAGGCCTGCAAGCCCCTGG + Intronic
923148234 1:231212645-231212667 CACCGTTGCCTGGAACCCCTGGG - Intronic
923277679 1:232412744-232412766 CACCATGACATGCCACCCTATGG + Intronic
924344745 1:243063464-243063486 CACCATGCCCAGCAATCACAAGG - Intergenic
924744325 1:246818306-246818328 CACCGCAGCCTGCAACCCCCAGG - Intergenic
1063385509 10:5613928-5613950 CACTATGGCCTGCAGCTTCAGGG - Intergenic
1065801844 10:29359420-29359442 CACTGTGGCCTGCAACTCCTGGG + Intergenic
1066731587 10:38441613-38441635 CACCATGCCCAGCAATCACAAGG + Intergenic
1068496609 10:57791214-57791236 CAACATGACCTGTAACCACATGG + Intergenic
1070775115 10:79105003-79105025 CACCATGGCTTTAAAACCCATGG - Intronic
1073462919 10:103676853-103676875 CACCAAGGCAGGCCACCCCAGGG - Intronic
1075164136 10:120051780-120051802 CATCATGGCCCGGGACCCCAGGG + Intergenic
1075594742 10:123720771-123720793 AATCCTGGCCTGCATCCCCAGGG - Intronic
1075878464 10:125827893-125827915 CACCATGGCCTTCAACTTCTTGG - Intronic
1076300433 10:129421533-129421555 CACCAAGGCCTGCATGCCCCTGG - Intergenic
1076409152 10:130233598-130233620 CACCACGGGCTGGAGCCCCAAGG - Intergenic
1079092312 11:17489584-17489606 CACCAAGTAGTGCAACCCCAGGG - Intergenic
1079173440 11:18117539-18117561 CACCATAGCCTCCAACTCCTGGG - Intronic
1079618942 11:22529236-22529258 CACCATGCTATGCTACCCCAAGG + Intergenic
1079974650 11:27076398-27076420 CACCGTTGCCTGCAGCACCATGG - Intronic
1080304168 11:30818821-30818843 CAGCATGCCCTTCAAGCCCAGGG - Intergenic
1080853919 11:36095108-36095130 CACCATAGCCTTCAACTCCTGGG - Intronic
1082262163 11:50084853-50084875 CACCATGCCCAGCAATCACAAGG - Intergenic
1083314644 11:61806923-61806945 CACCATGGCCTGCAGCTGGATGG + Intronic
1083407140 11:62465324-62465346 CACCATGCCCAGCGACCGCACGG - Intronic
1083960717 11:66013421-66013443 CACCATGGCCCCAAACCCAATGG - Exonic
1084180080 11:67441757-67441779 CATCATCGCCTGGCACCCCACGG - Exonic
1084189785 11:67493716-67493738 CATCATGGGCAGCGACCCCAAGG - Exonic
1084709659 11:70836113-70836135 CAACATGGCCTGCTTGCCCATGG + Intronic
1084758944 11:71256194-71256216 CAGGATGCCCTGCACCCCCAAGG - Intergenic
1085716434 11:78877652-78877674 CCCCAGGGCCTCCAACCCCTAGG + Intronic
1089060806 11:115624585-115624607 CACCATGCCCTGCAACTCCCAGG + Intergenic
1093654371 12:21677650-21677672 CACCAAGGCAAGAAACCCCAGGG + Intronic
1097378324 12:58864140-58864162 CTCCATTTCCTGCAACACCAAGG - Intergenic
1100494539 12:95112309-95112331 CACCATGCCCAGCAACGCCTGGG - Intronic
1101329488 12:103745996-103746018 CGCCATGCCCTGTGACCCCAGGG - Intronic
1102984598 12:117268016-117268038 CACCAGGGCCCGCACCACCAGGG - Intronic
1103723615 12:122987309-122987331 CATCATGGGCAGCGACCCCAAGG - Exonic
1104573853 12:129948974-129948996 CACCATGCCCTGCCATCACATGG - Intergenic
1113523530 13:110956677-110956699 CAGCACGGCCTGCATCCCCGGGG + Intergenic
1113701736 13:112393558-112393580 CAGCACGGCCTGCATCCCCGGGG - Intronic
1114365868 14:22026587-22026609 CACCATTGCCTGCAGCACCCTGG + Intergenic
1114623971 14:24116436-24116458 CACCACAGCCTGCAACTCCTGGG + Intronic
1114697875 14:24644403-24644425 CACCATTGCCTGCATCACCCTGG + Intergenic
1115397685 14:32927238-32927260 CACCATAGCCTGGAACTCCTGGG - Intergenic
1116919702 14:50560262-50560284 CACCATGGCCAAGAACCGCAGGG + Exonic
1120140703 14:80926817-80926839 CACCATTGCCTGCATCACCCTGG + Intronic
1120380189 14:83767817-83767839 CATCATGGCCTGCAGTCTCAGGG + Intergenic
1120925483 14:89793399-89793421 CCACATGGCCTGGAAACCCAAGG - Intergenic
1122480233 14:102042486-102042508 CACCATGGAGATCAACCCCAAGG + Exonic
1122743615 14:103885665-103885687 CACCCTCGCCTGCAGCCCCAAGG + Intergenic
1122902402 14:104787289-104787311 CATCCTGGCCTGGAGCCCCAGGG + Intronic
1123191428 14:106575914-106575936 CACCATGGCCTGCACCACTTTGG - Intergenic
1126455723 15:48859956-48859978 CACTAGAGCCTGCAACCCCTGGG - Intronic
1129033133 15:72632534-72632556 CACCATAGCCTCCAACTCCTGGG + Intergenic
1129216750 15:74104696-74104718 CACCATAGCCTCCAACTCCTGGG - Intronic
1129407925 15:75331389-75331411 CACCATAGCCTCCAACTCCTGGG + Intergenic
1131273629 15:90961826-90961848 AACCATTGCCTGCACCCCAAGGG + Exonic
1132540331 16:505460-505482 CAGAAGGGCCTGCACCCCCAAGG - Intronic
1132605246 16:790982-791004 CACCAGGGGCTCCACCCCCACGG - Intronic
1132938922 16:2497355-2497377 CACGATGCCTTGCGACCCCATGG - Intronic
1133211781 16:4267320-4267342 CACCATGCCCAGCCACACCAAGG + Intronic
1133822036 16:9245515-9245537 CTCCATGGTCTCCATCCCCAGGG + Intergenic
1135004700 16:18809355-18809377 CACCATGGCCTGCAACCCCAGGG - Exonic
1135834882 16:25816169-25816191 CACCATGCCCTGCAAAGCCACGG - Intronic
1136008845 16:27349205-27349227 CTCCACTGCCTGCAACTCCAGGG - Intronic
1136277883 16:29189977-29189999 CACAATGGCCAGCAAGCACATGG - Intergenic
1136924878 16:34362584-34362606 TCCCATGGCCTGCAAGCCAAAGG + Intergenic
1136979695 16:35049222-35049244 TCCCATGGCCTGCAAGCCAAAGG - Intergenic
1138083210 16:54111636-54111658 CACCATGACCTTCACCCCCGAGG + Intronic
1139490734 16:67284699-67284721 CGTCAAGGCCTGCAACACCAGGG - Exonic
1139504703 16:67393108-67393130 ATCCATGGCCTGCAGACCCATGG - Intronic
1140467356 16:75193229-75193251 CACCATGGCCTGGGGCCCTAAGG - Intergenic
1141889588 16:86917807-86917829 CTCCAGGCCCTGCAACCCCGAGG - Intergenic
1141972170 16:87491809-87491831 CACCATGGCCTCCAACCACCCGG - Exonic
1142082257 16:88156017-88156039 CACAATGGCCAGCAAGCACATGG - Intergenic
1142190920 16:88716965-88716987 CACCTTGGCCAGAACCCCCAGGG + Intronic
1142279853 16:89142155-89142177 CTGCCTGGCCTCCAACCCCAGGG - Intronic
1142380823 16:89730942-89730964 GGCCAGGGCCTGCACCCCCATGG + Intronic
1142718833 17:1762975-1762997 CTCCCTGCCCTCCAACCCCACGG - Intronic
1143779172 17:9220485-9220507 CACCAGGGCCTGCCAGCCCTTGG - Intronic
1144765516 17:17730458-17730480 CGCCATGGGCTGCATCCCCATGG - Intronic
1145215577 17:21049275-21049297 CACTATAGCCTGCAACTCCTGGG - Intergenic
1146288945 17:31594468-31594490 CACAGTGGTCTGCAAGCCCAGGG - Intergenic
1147140115 17:38455876-38455898 CACGGTGCCCTGCACCCCCATGG - Intronic
1147187494 17:38720548-38720570 CCCTATGGCCTGCCTCCCCAAGG + Exonic
1147384701 17:40074313-40074335 CACCATGCCCTGCGCCCCAAGGG - Exonic
1147786214 17:42980499-42980521 CGCGGTGGCCTGGAACCCCAGGG - Exonic
1147948069 17:44091724-44091746 GACCGTGGCCTGCAGCCCTAGGG + Exonic
1148345182 17:46898382-46898404 TGCCTTGGCCTGCTACCCCAAGG + Intergenic
1148978283 17:51548533-51548555 CACCCGTGCCTGCAGCCCCAGGG + Intergenic
1150206108 17:63409245-63409267 CACCAAAGCCTGGAACCCCTGGG + Intronic
1150273592 17:63882131-63882153 CACCATGGCCTGCTGCCAGAGGG - Intergenic
1150275786 17:63896843-63896865 CAACATGGCCTGCAGCCAGAGGG - Intergenic
1150277918 17:63911527-63911549 CACCATGGCCTGCTGCCAGAGGG - Intronic
1150279205 17:63919107-63919129 CACCATGGCCTGCGGCCAGAGGG - Intergenic
1150564509 17:66326991-66327013 CACTATAGCCTTCAACTCCAGGG - Intronic
1150782233 17:68133514-68133536 GACCATGGCAGGCAACCCCGGGG - Intergenic
1153045333 18:850691-850713 CACTATGGCCTCCAACTCCTGGG + Intergenic
1153959327 18:10127395-10127417 AACAATGGCCTCCAAGCCCAGGG + Intergenic
1154338782 18:13486491-13486513 CACCAGGGCCTGCTCCACCAGGG + Intronic
1155176131 18:23302772-23302794 CACCATGGCCTCCACCACCCTGG - Intronic
1157234747 18:45953828-45953850 GACCATTGGATGCAACCCCATGG + Intronic
1157244209 18:46039316-46039338 TACCATGCCCTGCCACCCCCAGG + Intronic
1158073649 18:53503189-53503211 CAAAATGCTCTGCAACCCCATGG - Intronic
1158984948 18:62804466-62804488 CACCTTGGCCTCCCAGCCCAAGG - Intronic
1161144311 19:2668494-2668516 CACCAAGGACCCCAACCCCAGGG + Intronic
1161261591 19:3340777-3340799 CTCCCTGGCCTGGAGCCCCAGGG + Intergenic
1161452013 19:4351530-4351552 CACAATGACCTCCAACTCCACGG - Intronic
1162232782 19:9281557-9281579 CACCATGGCCTTCCATTCCAGGG + Intergenic
1162307010 19:9881183-9881205 CACTGTGCCCGGCAACCCCAGGG + Intronic
1164851538 19:31488460-31488482 CACCAAGGCCTCCTGCCCCAGGG + Intergenic
1165243487 19:34484344-34484366 CCCTCTGGGCTGCAACCCCAGGG - Intronic
1165488855 19:36111634-36111656 CACCAGGGCCGGCAGCCACAGGG + Intronic
1166130751 19:40744283-40744305 CACCATGACCTTCCACCCCTTGG + Intronic
1167421929 19:49409087-49409109 CACCCTGGCCTCCAGCCCCAAGG + Intronic
1167455486 19:49595316-49595338 CAACCTGGCCTGCAGCCCCCTGG + Exonic
1168173919 19:54609123-54609145 CACCATTGCCAGCAACCCCCTGG + Intronic
927719095 2:25371919-25371941 CACCCTGGCTTTAAACCCCATGG + Intergenic
928266452 2:29816034-29816056 TACCAGCGCCTCCAACCCCAAGG - Intronic
928361258 2:30663967-30663989 CAACCTGGCCTGCAACCCTTTGG + Intergenic
929532832 2:42763280-42763302 CACCATGGCCAGCACACGCATGG + Exonic
929815070 2:45223865-45223887 CACCAGGGCCTGGCATCCCATGG - Intergenic
930018048 2:46984357-46984379 CAGAGTGGCCTCCAACCCCAGGG - Intronic
933341026 2:81026192-81026214 CACCACTGCCTGCAACACCTTGG - Intergenic
935028110 2:99296627-99296649 CACCAAGCCCTGCCACTCCAGGG + Intronic
935368041 2:102315248-102315270 GAGGATGACCTGCAACCCCAGGG - Intronic
935949662 2:108317133-108317155 CACCACTGCCTGCAACACCCTGG + Intergenic
936023021 2:109009599-109009621 CACCACAGCCTCCAACTCCAGGG + Intergenic
936879441 2:117232450-117232472 CACCATTGCTTGCAACACCCTGG - Intergenic
937911282 2:127076840-127076862 CACCCAGGGCTGCAATCCCAGGG + Intronic
937917118 2:127104800-127104822 GAGCAGGGCCTGCAACCCAAAGG + Intronic
937986455 2:127640267-127640289 CACCATCGCCTTCAATCACATGG + Exonic
938903759 2:135819941-135819963 CTCCATGGCCGGCAAACCCAGGG - Intronic
939305184 2:140401833-140401855 CACCATTGCCTGCAACACCCTGG + Intronic
939854871 2:147346132-147346154 CACCATTGCCTACAACTACATGG - Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
947672682 2:231948861-231948883 CACCATGGCCTCCACCCCCTGGG + Intergenic
947913131 2:233814652-233814674 CACCATCTCCTGCAGCCCCTTGG - Exonic
948462704 2:238138069-238138091 CTCCTTGCCCTGCTACCCCATGG - Intergenic
948871020 2:240798129-240798151 CACCAGCGCCTGCATCCACAGGG - Intronic
1169735334 20:8831703-8831725 CACCATAGCCTGAAACTCCTGGG + Intronic
1170399132 20:15960803-15960825 CACCATCGGCTCCAACCTCAGGG + Intronic
1170550780 20:17474318-17474340 CAGCATGGCCTGTGACCCCCAGG + Intronic
1174476885 20:50801969-50801991 CACCAGGGCCTGGGTCCCCAGGG + Intronic
1174974470 20:55316291-55316313 CACCACGGCCTCCAACTCCTGGG + Intergenic
1175403012 20:58711227-58711249 GTCCATGGCCTGGAGCCCCATGG + Intronic
1175859246 20:62141430-62141452 CACCACATCCTGCAAACCCAGGG + Intronic
1175863773 20:62163778-62163800 CACCCTGGCCCTCACCCCCAGGG - Intronic
1175938281 20:62525251-62525273 CGCCATGGCCTGCAAGCACCAGG - Intergenic
1179023996 21:37665309-37665331 CACCATGGCCTGCCTTGCCAGGG - Intronic
1179373369 21:40827391-40827413 CACCATGGCCTCAAACTCCTGGG - Intronic
1182447655 22:30398761-30398783 CACCATGGTCTTCTGCCCCATGG - Intronic
1183508529 22:38222183-38222205 CAGGCTGGCCTGCACCCCCAGGG + Intronic
1184047276 22:41979275-41979297 CACCATGGCCTGCTCCGCCCTGG - Intronic
1184333613 22:43840810-43840832 AACCGTTGCCTGCAACCCCCAGG + Intronic
1185059245 22:48597471-48597493 CACCATGGCCTGCATCACCTGGG + Intronic
1185059271 22:48597575-48597597 CACCATGGCCCGCATCACCTGGG + Intronic
1185231578 22:49686960-49686982 GACCATGGCCACCACCCCCAGGG + Intergenic
950262701 3:11554093-11554115 CACCCTGGCCGACACCCCCATGG - Intronic
952888904 3:38028550-38028572 CACTAAAGCCTCCAACCCCAAGG + Intronic
953542565 3:43834986-43835008 CACCATGCCCACCAGCCCCAAGG - Intergenic
954101870 3:48379902-48379924 CACTATGGCCTGGAACTCCTGGG - Intronic
954377284 3:50201887-50201909 CTGCCTGGCCTGCAACCTCAAGG + Intergenic
954467767 3:50666584-50666606 CTTCATGCCCTGCACCCCCATGG - Intergenic
956019980 3:64923896-64923918 CACCATGGCCTCGATCTCCATGG + Intergenic
956464547 3:69506149-69506171 GACCATCCACTGCAACCCCAAGG + Intronic
956750067 3:72338014-72338036 CTCCATGGCCGTCAGCCCCATGG + Intergenic
956934661 3:74086885-74086907 CACTATAGCCTTGAACCCCAGGG + Intergenic
960658119 3:120028700-120028722 CACCATGGCCTGCAAGGACATGG - Intronic
960967620 3:123116153-123116175 CACCCTGCCCTGCCTCCCCATGG - Intronic
962701176 3:138000886-138000908 CACTATGGCCTGTAACTGCATGG - Intronic
964763059 3:160152786-160152808 CACCATGGCCAGCCACCACCCGG + Intergenic
969238246 4:5882425-5882447 CTCCATAGCATACAACCCCAAGG - Intronic
970008115 4:11429188-11429210 CCCCTTGGACTGAAACCCCAGGG - Exonic
970640810 4:18064061-18064083 CAGCATAGCCTACAGCCCCAGGG - Intergenic
972018736 4:34281207-34281229 CACCATTGCCTGCATCACCCTGG - Intergenic
973108552 4:46371904-46371926 TACCATGTCCTACAACCCCAGGG - Intronic
979257971 4:118624222-118624244 CACCATGCCCAGCAATCACAAGG + Intergenic
979330378 4:119416341-119416363 CACCATGCCCAGCAATCACAAGG - Intergenic
981923848 4:150116782-150116804 CACCATGGCCTTCATCACCCTGG - Intronic
984648683 4:182246231-182246253 CACCACTGCCAGCAGCCCCAAGG + Intronic
985248168 4:187997045-187997067 GAGCATGGCCTGCAGCCCCCGGG + Intronic
986340851 5:6788166-6788188 CACCCTGCCCTGCAGCCCCTGGG - Intergenic
987335146 5:16892350-16892372 CACCGTGCCCGGCAACCCCATGG - Intronic
988260693 5:28882924-28882946 CATCATTGCCTGCAACACCCTGG + Intergenic
991414664 5:66379769-66379791 CACCACTGCCTGCAACACCCTGG + Intergenic
994703113 5:103162436-103162458 CACTGTGGCCTGAAACCCCTGGG + Intronic
995522824 5:113027129-113027151 CACCATGGCCAGTCGCCCCAAGG + Intronic
997661877 5:135595308-135595330 CACCATGTCCCACAACTCCAGGG - Intergenic
998715583 5:144880382-144880404 CACCCTGCCCTGCACCTCCAAGG + Intergenic
999220661 5:149974071-149974093 CACCATGGCCTCGAACTCCTGGG - Intronic
1002930986 6:1634894-1634916 CACCACCGCCTCCAACCCCAGGG - Intronic
1003569886 6:7248779-7248801 CACCAAGGACTGCAGCCACAGGG + Exonic
1004565950 6:16797971-16797993 CACCATGGCACTCTACCCCAAGG + Intergenic
1005395455 6:25377721-25377743 CACTATTGCCTGCAACACCCTGG - Intronic
1005765303 6:29005453-29005475 CGCCCCTGCCTGCAACCCCAGGG + Intergenic
1006291901 6:33144437-33144459 CACCATAGCCTGCACCTCCTGGG + Intergenic
1008495127 6:52125340-52125362 CACCCTGCCCTCCAAACCCAAGG - Intergenic
1009712956 6:67348080-67348102 CACCATGGCCTTATGCCCCAAGG - Intergenic
1012343507 6:98157175-98157197 CAGCAGGGCCTGGAACTCCAGGG - Intergenic
1013075168 6:106764696-106764718 CTCCATGGCCCGAAATCCCATGG - Intergenic
1014420949 6:121245086-121245108 CACCACTGCCTGCAACACCCTGG + Intronic
1014737704 6:125113276-125113298 CACAAGGGCCTGCAACACCATGG - Intergenic
1017863471 6:158421421-158421443 CACCATAGCCTGGAACCTCCCGG - Intronic
1018085798 6:160300324-160300346 GACCATGACCAGCAAACCCAAGG + Intergenic
1018909689 6:168094913-168094935 CACCAGGGACTGGAGCCCCAGGG + Intergenic
1019004160 6:168782449-168782471 CCCCATGGCCAGCATGCCCAGGG - Intergenic
1019162508 6:170078541-170078563 CACCATGTCCTTCATCACCAAGG + Intergenic
1019162532 6:170078696-170078718 CACCATGTCCTTCATCACCAAGG + Intergenic
1019162539 6:170078742-170078764 CACCATGTCCTTCATCACCAAGG + Intergenic
1019162546 6:170078788-170078810 CACCATGTCCTTCATCACCAAGG + Intergenic
1019162551 6:170078819-170078841 CACCATGTCCTTCATCACCAAGG + Intergenic
1019162556 6:170078850-170078872 CACCATGTCCTTCATCACCAAGG + Intergenic
1019162569 6:170078941-170078963 CACCATGTCCTTCATCACCAAGG + Intergenic
1019162633 6:170079488-170079510 CACCATGTCCTACATCACCAAGG + Intergenic
1019455030 7:1122581-1122603 CACCATGTCCGCCGACCCCAAGG + Intronic
1019488318 7:1299549-1299571 GTCCAAGGCCTGGAACCCCAAGG + Intergenic
1020218352 7:6213602-6213624 CTCCTTGGCCTTCAACCCCCAGG + Intronic
1023399959 7:39785508-39785530 CACCATGCCCAGCAATCACAAGG + Intergenic
1025184318 7:56845319-56845341 CACCATGCCCAGCAATCACAAGG - Intergenic
1025190914 7:56895174-56895196 CACAATGGGCTGCAGCCTCAAGG - Intergenic
1025681029 7:63681755-63681777 CACAATGGGCTGCAGCCTCAAGG + Intergenic
1025687610 7:63731649-63731671 CACCATGCCCAGCAATCACAAGG + Intergenic
1026558644 7:71429616-71429638 CATCATGGCCTCCAACTCCTGGG + Intronic
1027183229 7:75953875-75953897 GACCATTTCCTGCAGCCCCAGGG + Intronic
1029112862 7:98222551-98222573 CACCAGGGCCCCCACCCCCAGGG + Intronic
1029359787 7:100080416-100080438 CACCATAGCCTGGAACTCCTGGG - Intronic
1030002094 7:105075759-105075781 CACTATGGCCTCCAACTCCTGGG + Intronic
1030443628 7:109621026-109621048 CACCACAGCCTCCGACCCCATGG - Intergenic
1030808467 7:113945706-113945728 CACCATTGCCTGCATCACCCTGG + Intronic
1031964867 7:128020365-128020387 CACCATGACTTACAACTCCAGGG - Intronic
1032050275 7:128644982-128645004 CACCATGCCCAGCAATCACAAGG + Intergenic
1032326949 7:130937957-130937979 CACTATAGCCTTCAACTCCAGGG + Intergenic
1034315135 7:150123875-150123897 CTCCGTGGCCTGGAACCTCAGGG - Intergenic
1041351064 8:56948004-56948026 CACAATGGCCTGCAGCACCTGGG - Intergenic
1041714282 8:60920189-60920211 CACCACTCCCTGCAACTCCATGG + Intergenic
1045470723 8:102509828-102509850 CACTATGGCCTGGAACTCCCAGG - Intergenic
1045851009 8:106697742-106697764 CACCATGGCCTTCAAGCAGATGG - Intronic
1046986183 8:120391138-120391160 CACCATTGCCTGCACCACCCTGG - Intronic
1047494426 8:125399473-125399495 CACCATGCCCGGCTCCCCCAAGG + Intergenic
1048920818 8:139228488-139228510 CACCATTGCTTGCTGCCCCACGG - Intergenic
1049271518 8:141698652-141698674 CACCACGGGCTGCAACGCCAGGG - Intergenic
1049594948 8:143479016-143479038 CACCATAGCCTGGGAGCCCAGGG + Intronic
1049615661 8:143574868-143574890 CACCAGGGCCTGCAGCCTCTCGG + Exonic
1049707567 8:144049973-144049995 CAGCCTCGCCTGCAACACCACGG - Intergenic
1056759992 9:89407677-89407699 CATCATGGCCAGCAAGGCCATGG + Intronic
1057340595 9:94198037-94198059 CACCATCGCCTGCACCACCCTGG - Intergenic
1057340998 9:94201216-94201238 CAACCAGGACTGCAACCCCAGGG + Intergenic
1058236561 9:102497846-102497868 GACCATGGGCTCCGACCCCATGG + Intergenic
1058620878 9:106881340-106881362 CACCATGGCCCTCACCACCAAGG - Intronic
1059209691 9:112501365-112501387 CACCATGGCCTTGAACTCCTGGG - Intronic
1059906234 9:118989993-118990015 CACTATGGCCTCAAACCCCTGGG + Intergenic
1060488229 9:124062979-124063001 CAGCATGGCCGCCATCCCCATGG - Intergenic
1060970338 9:127734245-127734267 CACCATGGGGTGCCACCCTAGGG - Intronic
1061507388 9:131039162-131039184 CACCTGCGCCTGCAAGCCCACGG + Exonic
1061918316 9:133768752-133768774 CACACTGGCCTCCAATCCCAGGG + Intronic
1062039142 9:134396203-134396225 CACCATGGCCGGCATCTCCTGGG + Intronic
1062316839 9:135971577-135971599 GCCCCTGGCCTGCAACCCCCTGG - Intergenic
1062662027 9:137641913-137641935 CCCCATGCCCTCCAACTCCATGG + Intronic
1185808478 X:3081958-3081980 CTTCCTGTCCTGCAACCCCACGG - Intronic
1186728363 X:12381828-12381850 ACCCATGGCCTGGAACCCAATGG + Intronic
1189986047 X:46554147-46554169 CACCATGGCCTGCCAGCACTTGG + Intergenic
1192682612 X:73267553-73267575 CACCATTGCCTGCAGCACCATGG + Intergenic
1193469024 X:81876690-81876712 CCCCAGGCCCAGCAACCCCAAGG - Intergenic
1196599451 X:117585064-117585086 CACCACTGCCTGCAACACCCTGG - Intergenic
1197603776 X:128560928-128560950 CACCACAGCCTGCAACACCCTGG + Intergenic
1198146381 X:133861625-133861647 CACCAGGGCCTCCAACACTAGGG - Intronic
1199861222 X:151801680-151801702 GACCATGGCCTCCCACTCCATGG - Intergenic
1201516415 Y:14822961-14822983 CACCATTGCCTGCAGCTTCAAGG - Intronic