ID: 1135008311

View in Genome Browser
Species Human (GRCh38)
Location 16:18848637-18848659
Sequence CAGCTCAGTGAGCCTGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135008307_1135008311 15 Left 1135008307 16:18848599-18848621 CCTGGCCAAAAATTGGTATAATT No data
Right 1135008311 16:18848637-18848659 CAGCTCAGTGAGCCTGGCAGAGG No data
1135008308_1135008311 10 Left 1135008308 16:18848604-18848626 CCAAAAATTGGTATAATTCTTAT No data
Right 1135008311 16:18848637-18848659 CAGCTCAGTGAGCCTGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135008311 Original CRISPR CAGCTCAGTGAGCCTGGCAG AGG Intronic
No off target data available for this crispr