ID: 1135017211

View in Genome Browser
Species Human (GRCh38)
Location 16:18933849-18933871
Sequence CAGCAAACATCAGGGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135017203_1135017211 14 Left 1135017203 16:18933812-18933834 CCAAATTATCAACAAGTATTGGG No data
Right 1135017211 16:18933849-18933871 CAGCAAACATCAGGGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135017211 Original CRISPR CAGCAAACATCAGGGATGGA AGG Intergenic
No off target data available for this crispr