ID: 1135020817

View in Genome Browser
Species Human (GRCh38)
Location 16:18961664-18961686
Sequence CTGGAGTTCTAGAGAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135020817_1135020825 27 Left 1135020817 16:18961664-18961686 CCATCCTCTCTCTAGAACTCCAG No data
Right 1135020825 16:18961714-18961736 ATCTCTACCTGGACATCCACAGG No data
1135020817_1135020819 -6 Left 1135020817 16:18961664-18961686 CCATCCTCTCTCTAGAACTCCAG No data
Right 1135020819 16:18961681-18961703 CTCCAGTTCTGCCCACACAGTGG No data
1135020817_1135020823 16 Left 1135020817 16:18961664-18961686 CCATCCTCTCTCTAGAACTCCAG No data
Right 1135020823 16:18961703-18961725 GCTGACTCGCCATCTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135020817 Original CRISPR CTGGAGTTCTAGAGAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr