ID: 1135027381

View in Genome Browser
Species Human (GRCh38)
Location 16:19009100-19009122
Sequence CAAGCAGGAAACTTGGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135027381_1135027385 -6 Left 1135027381 16:19009100-19009122 CCAAGATCCAAGTTTCCTGCTTG 0: 1
1: 0
2: 3
3: 14
4: 179
Right 1135027385 16:19009117-19009139 TGCTTGGCTTCCGAACTCACTGG 0: 1
1: 0
2: 0
3: 2
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135027381 Original CRISPR CAAGCAGGAAACTTGGATCT TGG (reversed) Intronic
900097062 1:944087-944109 CAAGCAGGAGAATGGGACCTTGG + Exonic
902991568 1:20191143-20191165 CAAGCAGCAACCTTGGTTCTTGG - Exonic
903075953 1:20766592-20766614 CAGGAAGAAAAATTGGATCTGGG + Intronic
905646121 1:39626171-39626193 CAGGCATGAACCTTGGGTCTGGG - Exonic
908649780 1:66319600-66319622 GAACCTGGAAACTTGAATCTAGG - Intronic
911309770 1:96278017-96278039 CAAGCTGGAAACTGGGGACTTGG + Intergenic
912387077 1:109276475-109276497 CAAACACAAAACTTGGAACTAGG - Intergenic
915986749 1:160473680-160473702 CAATAAGGAAACTGGGAGCTAGG + Intergenic
916060807 1:161097507-161097529 AAAGCAGAAAGCTTGCATCTGGG + Intergenic
918261397 1:182799852-182799874 CAAGCATGGAATTTGGTTCTGGG + Intronic
918333279 1:183480836-183480858 CAAGAAGGAAGCATTGATCTGGG + Intronic
918658219 1:187055338-187055360 TAAGGAGGAAACTTGGAAGTTGG - Intergenic
919283124 1:195518009-195518031 AAAGCAAGAAACTTGGAGCCAGG + Intergenic
920755225 1:208723771-208723793 CAAGCAAGAAACATTGATATAGG - Intergenic
920792584 1:209107063-209107085 CCTGCAGGAAACTTGGTTTTGGG - Intergenic
922536518 1:226385100-226385122 CTAGCAGGAGAATTGGATCCAGG - Intronic
1067455946 10:46419345-46419367 CAAGCAGGACACATGGCTGTGGG + Intergenic
1067631254 10:47965294-47965316 CAAGCAGGACACATGGCTGTGGG - Intergenic
1068959009 10:62847831-62847853 CAAGCATAAGACTTGTATCTTGG - Intronic
1070131135 10:73656061-73656083 CAGGCAGGCAACTTGGCCCTGGG + Exonic
1070160189 10:73862081-73862103 CACGCAGCTCACTTGGATCTGGG - Intronic
1070236645 10:74634588-74634610 CAAGGAGCAAACTTGAATATAGG + Intronic
1072432606 10:95386752-95386774 GAAGCAGGAAAGTTGGAGTTGGG + Intronic
1072657055 10:97337128-97337150 CAGGAATGAGACTTGGATCTAGG - Intergenic
1075164547 10:120055310-120055332 CTACCATGAAACTTGGATCTTGG - Intergenic
1075673058 10:124277339-124277361 TAAGCTGGAAACTTGGCTATGGG - Intergenic
1076468285 10:130700829-130700851 CAAGCAGAAAACGTGGATGGAGG + Intergenic
1079127508 11:17728996-17729018 CAGGTAGATAACTTGGATCTTGG - Intergenic
1081353723 11:42087796-42087818 CAAGAAGCAAACTAGAATCTTGG + Intergenic
1082009533 11:47441095-47441117 CAAGTGGGGAACTTGGGTCTGGG - Intronic
1082562262 11:54632557-54632579 GAAGCTGGAAAATAGGATCTTGG - Intergenic
1082683928 11:56215224-56215246 CGGGCAGGAACCTTGGGTCTGGG - Intergenic
1086591634 11:88521936-88521958 CCACCAGGCAACTTGGCTCTGGG + Intronic
1087564943 11:99843229-99843251 CAAACAAAAAACTTGCATCTAGG + Intronic
1088991792 11:114960432-114960454 AAAGCAGCAGACTTGGTTCTAGG + Intergenic
1089640591 11:119844954-119844976 CTTGCTGGAAACTTGGGTCTCGG - Intergenic
1090597242 11:128333357-128333379 CCAGCTGGAAGCTGGGATCTGGG - Intergenic
1091226311 11:133958264-133958286 CAAGAAGGAGACTTGCTTCTGGG + Intergenic
1092439831 12:8490560-8490582 CAGGCAGGTCACTTGAATCTAGG + Intergenic
1092929165 12:13299042-13299064 CAAGGAGCAAGCCTGGATCTAGG + Intergenic
1096247191 12:49998100-49998122 AGAGCAGAAAACTTGGATGTTGG + Intronic
1096303788 12:50456423-50456445 CAAGAAGGAAACAAGGATTTGGG - Intronic
1096931922 12:55221086-55221108 AAAGAGGGAAACTTGCATCTCGG - Exonic
1101560315 12:105851019-105851041 CAAGCAGGCAAGATGGATATGGG + Intergenic
1102090262 12:110181114-110181136 CAACGAGGAAACTTTCATCTGGG + Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102680865 12:114689436-114689458 CAAGTAGGAAGCTGGGAGCTGGG - Intergenic
1105598219 13:21860338-21860360 CAAGTTGGAAACTTGGAACTTGG - Intergenic
1105758822 13:23494554-23494576 CCAGCAGGGAACTTGGATAGTGG - Intergenic
1107456992 13:40564079-40564101 CAACCAGGAAGCTTCTATCTGGG - Intronic
1107601003 13:42012288-42012310 AAAGCAGGAAAACTGGCTCTTGG + Intergenic
1107756683 13:43631283-43631305 ACAGCAGGAAACCTGGTTCTGGG + Intronic
1110068392 13:71140223-71140245 GAATCAGAAAACTTTGATCTAGG + Intergenic
1115296260 14:31830753-31830775 CAGGCAGGATACTTTGATCTGGG + Intronic
1117115012 14:52502227-52502249 CAACTAGGGAACTTGGATATAGG - Intronic
1118243191 14:64081730-64081752 CAAGCAGTAGACATGGATTTTGG + Intronic
1126920647 15:53519518-53519540 TAAGCCGGAAACTTCAATCTGGG + Intronic
1128614562 15:69099088-69099110 GAAGCTGGAAACTTGGAGCCTGG + Intergenic
1128681930 15:69658710-69658732 CAAGAAGGATGCATGGATCTGGG + Intergenic
1130049781 15:80474237-80474259 CAGGGAGGAAACTGGGATCAAGG - Intronic
1133720645 16:8491318-8491340 CAAGTGGCAAAATTGGATCTGGG + Intergenic
1135027381 16:19009100-19009122 CAAGCAGGAAACTTGGATCTTGG - Intronic
1135743652 16:24997951-24997973 CCAGCAGCAAACACGGATCTGGG + Intronic
1139111338 16:63894722-63894744 CAATCAGCAAACATGGATCATGG + Intergenic
1140357821 16:74321021-74321043 CAGGCTGGAAACTGGGGTCTTGG + Intergenic
1142165010 16:88581800-88581822 CCAGCAGGAAAGGTGGTTCTGGG - Intronic
1142788626 17:2245361-2245383 CAAGCTGGAAACTGCAATCTGGG + Intronic
1142839091 17:2613323-2613345 CAAGCAAGAAAATGGGACCTTGG - Intronic
1146182453 17:30706909-30706931 CAGGCTGGACACCTGGATCTGGG - Intergenic
1146298833 17:31672420-31672442 AAAACAGGAAACTAGGAGCTTGG - Intergenic
1146780442 17:35666422-35666444 CTAGCAGAAAATTTGGATTTAGG + Intronic
1149783893 17:59419705-59419727 ACAGCAGGAAACTTGGAACGAGG + Intergenic
1149972910 17:61236891-61236913 GAGGCAGGAAAGTTGGATCCTGG + Intronic
1151333359 17:73424217-73424239 CAGGCAGGACACTGGGATCGGGG + Intronic
1153968325 18:10202068-10202090 CGATGAGGAAACTGGGATCTAGG + Intergenic
1155705225 18:28802125-28802147 AAAGCAGGAAAATTGGGTCATGG + Intergenic
1156274983 18:35575810-35575832 CAAGAAGGAAACAGGGAACTTGG - Intergenic
1159378074 18:67620133-67620155 CAAGCATGCATCTAGGATCTAGG - Intergenic
1159986033 18:74841818-74841840 CAAGCTGGATACTTGAGTCTAGG - Intronic
1160330053 18:77983114-77983136 CAAGCAGGACAGTTGGTTATGGG + Intergenic
1161052479 19:2171722-2171744 CACGCAGCAAGCCTGGATCTTGG - Intronic
1163022820 19:14492624-14492646 AAAGGAGGAAGCTTGAATCTTGG - Intronic
1165314743 19:35047768-35047790 CAAGCAGATAACTTGAGTCTGGG + Intronic
1166365896 19:42278300-42278322 CAGGCAGGAAGCTGGGAGCTGGG - Intronic
925417353 2:3679973-3679995 CAAGCAGCAAACTTGGAAGAAGG + Exonic
927885438 2:26715529-26715551 CATGCAGGAGACCAGGATCTTGG - Intronic
927952388 2:27181062-27181084 CAAGTAGGAAAAATGGTTCTTGG - Intergenic
928129849 2:28641639-28641661 CAGGCAGTATACTAGGATCTGGG + Intronic
928328138 2:30336237-30336259 CAGTCAGGCAACCTGGATCTGGG + Intergenic
934618974 2:95792571-95792593 CAAGCAGGAAGCTTGGTTCTGGG + Intergenic
934641917 2:96031986-96032008 CAAGCAGGAAGCTTGGTTCTGGG - Intronic
936394633 2:112113271-112113293 TAAGCAGGAAATTTGGATAGAGG + Intronic
936480505 2:112880640-112880662 CAAGCAGGAACCATGGATGTTGG + Intergenic
940204863 2:151191834-151191856 GAAGCAGGAAAGCTGGATTTTGG - Intergenic
940609844 2:155976397-155976419 TAGACAGGAAACTTGGATTTGGG - Intergenic
940611623 2:155999854-155999876 ATAGCAGGAAACTGGGAGCTCGG - Intergenic
942664227 2:178299934-178299956 AAATCAGGAAACTTGCATCTAGG + Intronic
942995443 2:182254751-182254773 CAAGCAGGGGACCTGGATCGGGG - Intronic
943393035 2:187294666-187294688 CAAGCAGAAAACTGGATTCTGGG - Intergenic
946520243 2:220456693-220456715 CACCTAGGAAACTTGGACCTAGG - Intergenic
946521045 2:220465082-220465104 AAATCTGGAAACATGGATCTGGG + Intergenic
947565842 2:231192463-231192485 CTTCCAGGAAAGTTGGATCTTGG - Intergenic
1168756556 20:322454-322476 CAGGCAGTGAACTTGGAACTGGG - Intergenic
1168891722 20:1299405-1299427 CAAACAGAAACCTTGGATCTTGG - Intronic
1169452949 20:5727873-5727895 CAAACAGAAAATTTGGTTCTGGG - Intergenic
1170927976 20:20743108-20743130 CAAGCAGGAAACCAGGTTCATGG + Intergenic
1174447055 20:50597502-50597524 CTGGCAGGAAACGTGGAGCTCGG + Intronic
1177980147 21:27903580-27903602 GAAAAAGGAAACTTGGATTTTGG - Intergenic
1180556792 22:16584761-16584783 CCAGCAGGAAAGGTGGATCCCGG - Intergenic
1183607335 22:38873172-38873194 CAAGTGGGAAGCTGGGATCTGGG - Intergenic
953033837 3:39194347-39194369 GAGGCAGGAAAATTGAATCTGGG + Intergenic
953704268 3:45219559-45219581 CAAGTAGGAAACTTGTACTTGGG + Intergenic
955351760 3:58198762-58198784 CAAGCAGGAAAAGTGAATTTGGG + Intronic
956578992 3:70789057-70789079 AAAGAAGGAAACTTGGAACAAGG - Intergenic
957446968 3:80325874-80325896 CCAGCAGCAAACTTGGTCCTGGG - Intergenic
958486349 3:94715675-94715697 CAAGCTGGAACCATGGATCATGG - Intergenic
959916531 3:111822740-111822762 CAAGCAGGGAATTTGGACCAAGG - Intronic
961723952 3:128913648-128913670 CAAGGAGGAGACTGGGAACTTGG + Intronic
964012914 3:151912420-151912442 CAAATGGGATACTTGGATCTAGG + Intergenic
964081116 3:152758847-152758869 CATGCAAGAAACTTGAAACTAGG + Intergenic
964501487 3:157353125-157353147 GATGCAGGTAACTTGGAACTAGG - Intronic
967316911 3:188158315-188158337 CATGCAGGAAGCTAGTATCTGGG + Intronic
968477768 4:820511-820533 CATGGAGGCAACTGGGATCTGGG - Intronic
971296491 4:25398289-25398311 CAAGCAAGAAACAAGGACCTAGG + Intronic
971422080 4:26482469-26482491 CAAGCAGGAACCTTCCCTCTGGG - Intronic
971992831 4:33923185-33923207 CAAGAAGGAAAATTGTATTTTGG + Intergenic
972894302 4:43599657-43599679 CAGGCAGGAAAATAGGGTCTTGG - Intergenic
973255905 4:48113103-48113125 CAAGCAGGATACTAGATTCTGGG + Intronic
973818228 4:54638817-54638839 CAATCAGAAGACTTGGTTCTAGG + Intergenic
974103863 4:57445655-57445677 CAGGCAGGAGGCTTGGATCCTGG + Intergenic
974213304 4:58811153-58811175 CAGGCAGGACACTTGGCTGTAGG + Intergenic
974717520 4:65688317-65688339 CAAGAATTAAATTTGGATCTAGG + Intergenic
976103799 4:81594634-81594656 TAATCAGAAAACATGGATCTCGG + Intronic
976325484 4:83766703-83766725 AAAGCAGGAAATTTGGATGGAGG + Intergenic
976459062 4:85286500-85286522 CAGGCAGAAAACTGGGAGCTGGG - Intergenic
976593550 4:86873179-86873201 CTATCAGGACACTGGGATCTAGG + Intergenic
977368258 4:96101296-96101318 TAAGCAGGAAACTTGAGACTAGG - Intergenic
978623915 4:110663152-110663174 GCAGCAGGAAACTTCAATCTAGG - Intergenic
978770610 4:112452571-112452593 GAAGGAGCAAACTTGGACCTAGG + Intergenic
980244595 4:130223384-130223406 CAATGAGGAAACTTGGATGAGGG + Intergenic
980424846 4:132615807-132615829 CAAGCAGGAAATTTTAATTTGGG - Intergenic
981877501 4:149565198-149565220 GAATCAAGAAACTTGGGTCTGGG - Intergenic
986132561 5:4944370-4944392 AATGCAGGAATCTTGGACCTTGG - Intergenic
986203652 5:5602272-5602294 CAAGCAGGAAACTGACATCTAGG + Intergenic
987473625 5:18363271-18363293 AAAGAAAGAAATTTGGATCTTGG - Intergenic
988899713 5:35718827-35718849 TAGGCAGGAAAATTGGATCTAGG - Intronic
989438075 5:41437914-41437936 GAAGAAGGAAACCTGGATTTTGG - Intronic
992521148 5:77552853-77552875 AAAGCATGAAATTTAGATCTAGG - Intronic
993035780 5:82755702-82755724 AAATCAGGAAACTTGGGTTTAGG + Intergenic
996486742 5:124044092-124044114 CAAACAGGAAATATGTATCTAGG - Intergenic
997918937 5:137958692-137958714 CAAGCAATAAATTTGGATCTAGG - Intronic
999527187 5:152420018-152420040 CAAGCAGCAAACTTAAATCTTGG - Intronic
999611474 5:153374743-153374765 AAGCCAGGAAACTTGAATCTAGG - Intergenic
1000571796 5:162923990-162924012 CCAGCAGGAAGCTTGGATGTGGG + Intergenic
1003396077 6:5752989-5753011 CAATCAGGAAACTGAGAGCTGGG - Intronic
1003657865 6:8030481-8030503 CAAACAGAAATCTTGGAACTGGG + Intronic
1003746364 6:9006885-9006907 ACAGCAGGAAATTTGCATCTTGG - Intergenic
1003990105 6:11478075-11478097 GAAGAGAGAAACTTGGATCTGGG + Intergenic
1004115323 6:12761048-12761070 CAAGCAGCAGACTTGGGTTTTGG - Intronic
1005198493 6:23316332-23316354 CAGGCAGGAAATTTGGATCTGGG + Intergenic
1012636837 6:101553654-101553676 AAAGAAGGAAACTTTGACCTTGG - Intronic
1013916261 6:115340765-115340787 CAAAGAGGAAACTTGGATGCAGG + Intergenic
1015373283 6:132480381-132480403 CCAGAAAGAAACTTGGATTTGGG + Intronic
1018784879 6:167100280-167100302 CAAGAAGGAATCTTTGATGTGGG + Intergenic
1019571527 7:1715013-1715035 CAGGCAGGAAACTGGGAAGTGGG + Intronic
1021238963 7:18177506-18177528 CAAGCAAGAAAACTGGACCTGGG - Intronic
1024654313 7:51436332-51436354 TAAACATGAAACTTGGATCTTGG - Intergenic
1029259314 7:99291099-99291121 CATGCAGGTTACCTGGATCTTGG + Intergenic
1029376893 7:100183406-100183428 CAGGAAGGAAGCTTGGATGTGGG + Intronic
1030205445 7:106948282-106948304 GAAGGAGGAAAATTGGATTTTGG - Intergenic
1030249095 7:107421663-107421685 GAAGCAGGAAGCTTGAACCTGGG + Intronic
1031091662 7:117364309-117364331 TAAGCAAGAAATTTGCATCTGGG - Intronic
1035969645 8:4233603-4233625 CAACCAGGACACCTTGATCTTGG + Intronic
1036700522 8:11010694-11010716 AAAGCACGAATCTTGGAACTGGG - Intronic
1038319465 8:26514063-26514085 GAAGCGGCAAAGTTGGATCTGGG - Exonic
1039353971 8:36795035-36795057 CAAAGAGGAAACGTGGATTTAGG - Intronic
1040484191 8:47854750-47854772 CAAGCAGGGATATTGGATATGGG - Intronic
1041283563 8:56236647-56236669 TGAGCAGGAAATTTGGATTTGGG - Intergenic
1042017778 8:64335616-64335638 CAAACACTAAACTTGTATCTTGG + Intergenic
1042444324 8:68866503-68866525 CAAGCAGGATATTGGGCTCTGGG + Intergenic
1042567388 8:70126054-70126076 GAAACAGGAGACTTGGATTTCGG + Intronic
1043923949 8:86015844-86015866 AAAGCAAGAAACTTGGGACTTGG - Intronic
1046263282 8:111798933-111798955 TAAGCAGTAAAATTGGATGTTGG + Intergenic
1047289006 8:123512935-123512957 AAAGCTGGAAACTTGGCTTTTGG - Intronic
1047702032 8:127458275-127458297 CAAGCAGGAAAATTGAAGTTAGG - Intergenic
1047808718 8:128384776-128384798 CAAGGAGGATATTTGGGTCTTGG + Intergenic
1052533491 9:29718507-29718529 CAACTAGGAAATTTGGATCAGGG - Intergenic
1057113878 9:92501810-92501832 CCAGCAGACAACTGGGATCTGGG - Intronic
1058906824 9:109488821-109488843 CAGGCAGGAAACCAGCATCTAGG - Intronic
1059051879 9:110935243-110935265 AAGTCAGGAAACTTGGATCCTGG + Intronic
1060216519 9:121741722-121741744 CAAACAGGAAACTAGCCTCTTGG - Intronic
1191989789 X:67021799-67021821 CTAGCATGAATCTTGGAACTGGG - Intergenic
1195288093 X:103404933-103404955 GAACGAGGGAACTTGGATCTGGG - Intergenic
1196107995 X:111916744-111916766 GAAGCCGGAAACATGGATTTGGG + Intronic
1197347324 X:125340073-125340095 CAACCAAGAAACCTGGATCCTGG + Intergenic
1197551043 X:127893219-127893241 CAAACAGAAAATTTGGAACTGGG - Intergenic
1200829654 Y:7678518-7678540 CAAGGAGGAAGCATGGAACTCGG - Intergenic