ID: 1135031038

View in Genome Browser
Species Human (GRCh38)
Location 16:19038917-19038939
Sequence TTAGTTCAAAAATAACAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135031038_1135031042 5 Left 1135031038 16:19038917-19038939 CCTGACTGTTATTTTTGAACTAA No data
Right 1135031042 16:19038945-19038967 TGGTTTACCTAAAATAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135031038 Original CRISPR TTAGTTCAAAAATAACAGTC AGG (reversed) Intronic
No off target data available for this crispr