ID: 1135031159

View in Genome Browser
Species Human (GRCh38)
Location 16:19039772-19039794
Sequence TACTGTGCAGGAAGAAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135031159_1135031167 28 Left 1135031159 16:19039772-19039794 CCTGGTTTTCTTCCTGCACAGTA No data
Right 1135031167 16:19039823-19039845 AAGGAGATGGCGGCCGGGCGAGG No data
1135031159_1135031165 22 Left 1135031159 16:19039772-19039794 CCTGGTTTTCTTCCTGCACAGTA No data
Right 1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG No data
1135031159_1135031163 15 Left 1135031159 16:19039772-19039794 CCTGGTTTTCTTCCTGCACAGTA No data
Right 1135031163 16:19039810-19039832 TGAATATCTGAAGAAGGAGATGG No data
1135031159_1135031164 18 Left 1135031159 16:19039772-19039794 CCTGGTTTTCTTCCTGCACAGTA No data
Right 1135031164 16:19039813-19039835 ATATCTGAAGAAGGAGATGGCGG No data
1135031159_1135031162 9 Left 1135031159 16:19039772-19039794 CCTGGTTTTCTTCCTGCACAGTA No data
Right 1135031162 16:19039804-19039826 TCTTTTTGAATATCTGAAGAAGG No data
1135031159_1135031166 23 Left 1135031159 16:19039772-19039794 CCTGGTTTTCTTCCTGCACAGTA No data
Right 1135031166 16:19039818-19039840 TGAAGAAGGAGATGGCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135031159 Original CRISPR TACTGTGCAGGAAGAAAACC AGG (reversed) Intronic
No off target data available for this crispr