ID: 1135031160

View in Genome Browser
Species Human (GRCh38)
Location 16:19039784-19039806
Sequence AGAGGTATCTAGTACTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135031160_1135031162 -3 Left 1135031160 16:19039784-19039806 CCTGCACAGTACTAGATACCTCT No data
Right 1135031162 16:19039804-19039826 TCTTTTTGAATATCTGAAGAAGG No data
1135031160_1135031165 10 Left 1135031160 16:19039784-19039806 CCTGCACAGTACTAGATACCTCT No data
Right 1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG No data
1135031160_1135031166 11 Left 1135031160 16:19039784-19039806 CCTGCACAGTACTAGATACCTCT No data
Right 1135031166 16:19039818-19039840 TGAAGAAGGAGATGGCGGCCGGG No data
1135031160_1135031167 16 Left 1135031160 16:19039784-19039806 CCTGCACAGTACTAGATACCTCT No data
Right 1135031167 16:19039823-19039845 AAGGAGATGGCGGCCGGGCGAGG No data
1135031160_1135031163 3 Left 1135031160 16:19039784-19039806 CCTGCACAGTACTAGATACCTCT No data
Right 1135031163 16:19039810-19039832 TGAATATCTGAAGAAGGAGATGG No data
1135031160_1135031168 19 Left 1135031160 16:19039784-19039806 CCTGCACAGTACTAGATACCTCT No data
Right 1135031168 16:19039826-19039848 GAGATGGCGGCCGGGCGAGGTGG No data
1135031160_1135031164 6 Left 1135031160 16:19039784-19039806 CCTGCACAGTACTAGATACCTCT No data
Right 1135031164 16:19039813-19039835 ATATCTGAAGAAGGAGATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135031160 Original CRISPR AGAGGTATCTAGTACTGTGC AGG (reversed) Intronic
No off target data available for this crispr