ID: 1135031161

View in Genome Browser
Species Human (GRCh38)
Location 16:19039802-19039824
Sequence TTCTTCAGATATTCAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135031161_1135031168 1 Left 1135031161 16:19039802-19039824 CCTCTTTTTGAATATCTGAAGAA No data
Right 1135031168 16:19039826-19039848 GAGATGGCGGCCGGGCGAGGTGG No data
1135031161_1135031170 28 Left 1135031161 16:19039802-19039824 CCTCTTTTTGAATATCTGAAGAA No data
Right 1135031170 16:19039853-19039875 TGCCTGTAATCCTAGCACTTTGG 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055
1135031161_1135031171 29 Left 1135031161 16:19039802-19039824 CCTCTTTTTGAATATCTGAAGAA No data
Right 1135031171 16:19039854-19039876 GCCTGTAATCCTAGCACTTTGGG 0: 15701
1: 240057
2: 272945
3: 174764
4: 138480
1135031161_1135031167 -2 Left 1135031161 16:19039802-19039824 CCTCTTTTTGAATATCTGAAGAA No data
Right 1135031167 16:19039823-19039845 AAGGAGATGGCGGCCGGGCGAGG No data
1135031161_1135031166 -7 Left 1135031161 16:19039802-19039824 CCTCTTTTTGAATATCTGAAGAA No data
Right 1135031166 16:19039818-19039840 TGAAGAAGGAGATGGCGGCCGGG No data
1135031161_1135031165 -8 Left 1135031161 16:19039802-19039824 CCTCTTTTTGAATATCTGAAGAA No data
Right 1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135031161 Original CRISPR TTCTTCAGATATTCAAAAAG AGG (reversed) Intronic
No off target data available for this crispr