ID: 1135031165

View in Genome Browser
Species Human (GRCh38)
Location 16:19039817-19039839
Sequence CTGAAGAAGGAGATGGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135031159_1135031165 22 Left 1135031159 16:19039772-19039794 CCTGGTTTTCTTCCTGCACAGTA No data
Right 1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG No data
1135031160_1135031165 10 Left 1135031160 16:19039784-19039806 CCTGCACAGTACTAGATACCTCT No data
Right 1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG No data
1135031161_1135031165 -8 Left 1135031161 16:19039802-19039824 CCTCTTTTTGAATATCTGAAGAA No data
Right 1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135031165 Original CRISPR CTGAAGAAGGAGATGGCGGC CGG Intronic
No off target data available for this crispr