ID: 1135035835

View in Genome Browser
Species Human (GRCh38)
Location 16:19076041-19076063
Sequence CATACAGCACAGACAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 6, 3: 22, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135035830_1135035835 -9 Left 1135035830 16:19076027-19076049 CCGTCTGCCCTGGCCATACAGCA 0: 1
1: 0
2: 1
3: 24
4: 284
Right 1135035835 16:19076041-19076063 CATACAGCACAGACAGAGCTGGG 0: 1
1: 0
2: 6
3: 22
4: 319
1135035829_1135035835 -8 Left 1135035829 16:19076026-19076048 CCCGTCTGCCCTGGCCATACAGC 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1135035835 16:19076041-19076063 CATACAGCACAGACAGAGCTGGG 0: 1
1: 0
2: 6
3: 22
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135035835 Original CRISPR CATACAGCACAGACAGAGCT GGG Intronic
900577015 1:3388351-3388373 AATACAGCACAGACACAGAAGGG + Intronic
901056308 1:6450129-6450151 CACCCAGCACAGCCAGGGCTGGG + Intronic
901475053 1:9483604-9483626 CAAACAGGACAGACAGAAATTGG - Intergenic
902052070 1:13571630-13571652 GATATAGCAGAGAGAGAGCTTGG - Intergenic
902478041 1:16698361-16698383 CACCCAGCACAGCCAGGGCTGGG - Intergenic
902633099 1:17717589-17717611 CTGACATCACAGACAGAGGTGGG - Intergenic
902820129 1:18938593-18938615 AAGTCAGCACAGGCAGAGCTGGG - Intronic
903088275 1:20883664-20883686 AATAAAGGACAGAAAGAGCTAGG + Intronic
904376181 1:30083896-30083918 CACACAGCACAGACAGGGCTGGG + Intergenic
904591273 1:31616890-31616912 CGCACAGCAGAGGCAGAGCTGGG - Intergenic
906353510 1:45083543-45083565 CAGAAAGAACAGTCAGAGCTGGG - Intronic
912980371 1:114365666-114365688 GATATAGCAGAGAGAGAGCTTGG + Intergenic
913234161 1:116765701-116765723 CATGGAGAACAGCCAGAGCTGGG - Intronic
913469854 1:119176886-119176908 TATACATCACAGAGAGAGCCAGG + Intergenic
916114758 1:161477153-161477175 TATACATCACAGAGAGAGCAAGG + Intergenic
917311665 1:173685370-173685392 GATATAGCAGAGAGAGAGCTTGG + Intergenic
918045576 1:180939091-180939113 CCTTCAGCTCAGGCAGAGCTGGG + Intronic
918749995 1:188260074-188260096 TATACATCACAGAGAGAGCAGGG - Intergenic
919420197 1:197360458-197360480 CATAGAGAAGAGACAGAGCAAGG - Intronic
921263314 1:213402644-213402666 CATACACCAGAGCAAGAGCTGGG - Intergenic
922178475 1:223215326-223215348 CAGAGAGCACCGACAGAGCCTGG + Intergenic
922228271 1:223664554-223664576 AAAACAACACAGGCAGAGCTAGG + Intronic
923168340 1:231389037-231389059 TATACAGCTCATACAAAGCTGGG + Intronic
923746856 1:236709484-236709506 CATGGAGGACAGGCAGAGCTCGG - Intronic
924610992 1:245573780-245573802 AAAACAGCACATACAGGGCTCGG - Intronic
1064348703 10:14556971-14556993 CATGCAGCCCAGAAAGAGTTTGG - Intronic
1065612206 10:27483082-27483104 CCTACAACAAAGTCAGAGCTGGG - Intergenic
1066362354 10:34743671-34743693 CATACAGCACTGCCAGTGATGGG + Intronic
1066614263 10:37280065-37280087 TATACATCACAGAGAGAGCAGGG - Intronic
1067470602 10:46535219-46535241 CATGCAGCACTGACAGTGGTAGG - Intergenic
1067764286 10:49073458-49073480 CTTACACCCCAGACAGAGCATGG + Intronic
1069137010 10:64780244-64780266 TATACATCACAGATAGAGCAGGG - Intergenic
1070786991 10:79167764-79167786 CATACACCCTAGACGGAGCTAGG + Intronic
1071283037 10:84120119-84120141 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1071495229 10:86163324-86163346 CCCATAGCAGAGACAGAGCTAGG + Intronic
1072735488 10:97876227-97876249 CATACAGCCCAGACAGACGAAGG - Intronic
1072805899 10:98423967-98423989 CACCCAGGACAGACAGACCTGGG + Intronic
1073883407 10:108008917-108008939 CAGCAAGCAAAGACAGAGCTTGG + Intergenic
1074476727 10:113781022-113781044 CAAACACCACAGACACAGATTGG + Intronic
1075387645 10:122068631-122068653 CTCACAGCTCACACAGAGCTGGG - Intronic
1076439295 10:130469497-130469519 CAGACAGCAAAGACAAAGTTGGG - Intergenic
1077667270 11:4124019-4124041 GATACACCAGAGACAGGGCTGGG + Intronic
1077825621 11:5805673-5805695 GATATAGCAGAGAGAGAGCTTGG + Intronic
1078141070 11:8693455-8693477 CAGAGAGCACTGGCAGAGCTGGG + Exonic
1078267513 11:9766130-9766152 CACACAGCTCAGCCATAGCTGGG - Intergenic
1078559305 11:12356802-12356824 CATACAGCACACCAAGATCTGGG + Intronic
1079730878 11:23937004-23937026 TATACATCACAGAGAGAGCCGGG - Intergenic
1081667840 11:44926901-44926923 CAGGCAGCACAGACACAGCCGGG - Intronic
1082942932 11:58727128-58727150 CATAAAGCACTGGCAGAGCTGGG + Intronic
1083626922 11:64076674-64076696 CACACAGCTCAGAAAGAGGTTGG + Intronic
1084667336 11:70583453-70583475 CCTACAGCACAGCAAGTGCTCGG + Intronic
1084715230 11:70869466-70869488 CCTACAGCACAGGCTGAGATTGG - Intronic
1085239829 11:75044091-75044113 GATATAGCAGAGAGAGAGCTTGG - Intergenic
1086144474 11:83536481-83536503 CATGCATCCCAGAAAGAGCTAGG - Intronic
1086462154 11:87016752-87016774 GATATAGAACAGACAGAGCCTGG + Intergenic
1086905800 11:92416608-92416630 GATAAAGCACTGACAGAGTTTGG - Intronic
1087456753 11:98396416-98396438 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1087683021 11:101236089-101236111 CATACATCACAGACAGAGCAGGG - Intergenic
1088611779 11:111584541-111584563 CATTCAGCACTGACACAGCATGG - Intergenic
1089672688 11:120067490-120067512 AACACAGCACACACAGAGCGAGG - Intergenic
1090260323 11:125314655-125314677 TCTGCAGCACAGCCAGAGCTGGG - Intronic
1091814468 12:3426057-3426079 GATATAGCAGAGAGAGAGCTTGG + Intronic
1092556225 12:9564991-9565013 AATTCAGCACAAACAGAGGTCGG + Intergenic
1093234776 12:16594209-16594231 CATGCTGCACATACAGAGATTGG - Exonic
1093356837 12:18176980-18177002 GATATAGCAGAGAGAGAGCTTGG - Intronic
1093594068 12:20940749-20940771 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1093991674 12:25595566-25595588 GATACAGCAAAGGCAGTGCTAGG + Intronic
1094515867 12:31125661-31125683 AATTCAGCACAAACAGAGGTCGG - Intergenic
1095507900 12:42917505-42917527 CCTACACCAGAGACAGAGCCAGG + Intergenic
1095526361 12:43130518-43130540 CAAACAGCACTTCCAGAGCTGGG + Intergenic
1095605916 12:44067698-44067720 TATAGAGCACAGGCAGAGTTAGG + Intronic
1103722579 12:122982570-122982592 GGTACATCACAAACAGAGCTGGG - Intronic
1104194651 12:126522821-126522843 CATCCAGCAGAGACATTGCTGGG + Intergenic
1104203455 12:126614478-126614500 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1104701707 12:130909516-130909538 CTTAGAGCACACACAGGGCTGGG + Intergenic
1106163038 13:27217291-27217313 TATACATCACAGAGAGAGCAGGG + Intergenic
1106732697 13:32558141-32558163 CACAAAGAAAAGACAGAGCTGGG + Intergenic
1108697024 13:52911428-52911450 CATCCTGCTCAGACAGAGCCAGG - Intergenic
1112185681 13:97125831-97125853 CAAACAGGACAGACAGAATTTGG - Intergenic
1115211464 14:30970970-30970992 GATATAGCAGAGAGAGAGCTTGG - Intronic
1117031260 14:51673192-51673214 CCTACAGCTCACATAGAGCTGGG - Intronic
1117048943 14:51841421-51841443 CATACAGAACAAACAGTGCCAGG - Intronic
1121154080 14:91666494-91666516 TATACATCACAGAGAGAGCAGGG + Intronic
1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG + Intronic
1124477357 15:30045985-30046007 CACTCGGCACAGACAGAGTTTGG - Intergenic
1124934360 15:34156297-34156319 GATATAGCAGAGAAAGAGCTTGG + Intronic
1125690418 15:41591647-41591669 GATACAGCAGAGAGAGAGCTTGG - Intergenic
1125759466 15:42087151-42087173 CACACAGCACAGACAGGCCAGGG + Intronic
1126043574 15:44617153-44617175 CACCCAGCACAGAGAGAGCCAGG - Intronic
1126230009 15:46313273-46313295 CATCCAGTCCAGACAGGGCTGGG + Intergenic
1126797047 15:52267875-52267897 CCTTCAGCCCAGCCAGAGCTTGG + Intronic
1127341738 15:58052720-58052742 CATACATAAGTGACAGAGCTGGG + Intronic
1128759455 15:70205864-70205886 CATACAGCTCAGAAATAGCAAGG + Intergenic
1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG + Intergenic
1130025845 15:80269754-80269776 GATACAGCAGAGGGAGAGCTGGG - Intergenic
1130258093 15:82335065-82335087 CAGATAGAACAGACAGAGCCAGG - Intergenic
1130303708 15:82699285-82699307 GATACAGCACAGACAGGGTTTGG - Intronic
1130459833 15:84152692-84152714 GATAAAGCACAGACAGAGCCAGG - Intergenic
1130596838 15:85254898-85254920 CAGATAGAACAGACAGAGCCAGG + Intergenic
1131423059 15:92323291-92323313 AATGCAGCACAGACACAGCACGG - Intergenic
1132342805 15:101088747-101088769 CCTACAGCAGAGAAAGAACTCGG + Intergenic
1134248075 16:12554887-12554909 CATACAGGACAGGCAGTGCAGGG + Intronic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1135035835 16:19076041-19076063 CATACAGCACAGACAGAGCTGGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135339335 16:21632881-21632903 TATACATCACAGAGAGAGCAGGG - Intronic
1136396835 16:29997065-29997087 GATACAGCAGAGGCAGAGATAGG + Intronic
1137597438 16:49734232-49734254 CACACAGGACAGGCGGAGCTGGG - Intronic
1138474746 16:57264077-57264099 CCTAGAGCACAGACAGAGCTGGG + Intronic
1139244962 16:65432738-65432760 AATACAGCTCAGCCAGAACTGGG - Intergenic
1139349817 16:66327932-66327954 CATTCAGCAGAGACTCAGCTGGG - Intergenic
1139421299 16:66851051-66851073 AGAACAGCACAGACAAAGCTTGG - Intronic
1141240282 16:82259559-82259581 CATACAAAAAAGACAGAGATAGG + Intergenic
1141965814 16:87442230-87442252 CAAACAGCACCGCCACAGCTCGG + Intronic
1143031996 17:3973076-3973098 CATAGAGCACAGAGAGAGGCTGG - Intergenic
1143651541 17:8266748-8266770 CGAACAGCACAGACAGGACTGGG - Exonic
1145753259 17:27370331-27370353 CATAAAGGACAGACACAGCCAGG - Intergenic
1146841212 17:36155680-36155702 TATACCTCACAGACAGACCTGGG - Intergenic
1146853450 17:36243312-36243334 TATACCTCACAGACAGACCTGGG - Intronic
1146869360 17:36367204-36367226 TATACCTCACAGACAGACCTGGG - Intronic
1147072234 17:37967828-37967850 TATACCTCACAGACAGACCTGGG - Intergenic
1147083759 17:38047365-38047387 TATACCTCACAGACAGACCTGGG - Intronic
1147099705 17:38171332-38171354 TATACCTCACAGACAGACCTGGG - Intergenic
1147435344 17:40409461-40409483 CATAGAAGACAGACATAGCTGGG + Intronic
1148019238 17:44542486-44542508 TATGCAGCCCAGACAGGGCTGGG + Intergenic
1148575510 17:48707949-48707971 GATTCTGCACACACAGAGCTGGG + Intergenic
1149627247 17:58088588-58088610 CATACAGCCCACACAGTGCATGG + Intronic
1149858363 17:60105479-60105501 TATACCTCACAGACAGACCTGGG + Intergenic
1150082713 17:62254626-62254648 TATACCTCACAGACAGACCTGGG - Intergenic
1150115736 17:62547839-62547861 TATCCAGCACAGACAGACCCGGG + Intronic
1150116238 17:62552376-62552398 CATCCAGCACAGACAGACCCAGG + Exonic
1150656098 17:67040746-67040768 CATACAGGCCAGCCAGGGCTTGG - Intergenic
1150896618 17:69218725-69218747 CACACAGCACAAACAGTGTTCGG - Intronic
1151270295 17:72989258-72989280 CCCACAGCACAGCCAGATCTTGG + Intronic
1151377061 17:73697148-73697170 CACACAGCACACACTGGGCTTGG + Intergenic
1151819842 17:76491466-76491488 CAGACAGCAGAGACAGGGCCAGG + Intronic
1152260078 17:79262096-79262118 CATACAGCCCAGGCAGAGAAAGG - Intronic
1152801188 17:82331345-82331367 CCTGCTGCCCAGACAGAGCTGGG - Intronic
1153821369 18:8834882-8834904 CATACAGAGTAGACAGAGTTAGG - Intergenic
1153826332 18:8878409-8878431 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1155273987 18:24168495-24168517 CATACAGCACTAGCATAGCTGGG - Intronic
1155746115 18:29358003-29358025 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1157086600 18:44586672-44586694 CAGGCAGCACATGCAGAGCTTGG - Intergenic
1157857237 18:51114286-51114308 TATACATCACAGAGAGAGCCGGG - Intergenic
1158037168 18:53046880-53046902 TCTACAACACAGCCAGAGCTGGG + Intronic
1159535366 18:69707980-69708002 CGCACAGCACAGGCAGAGCACGG + Intronic
1160088800 18:75806622-75806644 CATAGAAGACAGACAGAGCCAGG + Intergenic
1160219555 18:76964214-76964236 GATACAGCAAAGGCAGTGCTAGG - Intronic
1160427743 18:78790027-78790049 CACCCAGCACCCACAGAGCTTGG + Intergenic
1160455277 18:78994914-78994936 CAGACACCACACACAGTGCTGGG - Exonic
1162341753 19:10095429-10095451 AATAAAGTGCAGACAGAGCTGGG + Intronic
1162625871 19:11884600-11884622 GATATAGCAGAGAGAGAGCTTGG - Intergenic
1164130675 19:22358497-22358519 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1164216913 19:23158559-23158581 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1166285883 19:41828018-41828040 CAGAAAGCACAGAGAGTGCTTGG - Intergenic
1166713041 19:44949216-44949238 CCTTCAGCACAGAAAGAACTTGG - Exonic
1202712061 1_KI270714v1_random:24188-24210 CACCCAGCACAGCCAGGGCTGGG - Intergenic
925035749 2:684206-684228 CACTGAGCACAGACAGAACTTGG + Intergenic
925103936 2:1272980-1273002 CGTATAGCACACACAGACCTAGG - Intronic
925803683 2:7627615-7627637 CATACAGCAGAAACACAGATGGG - Intergenic
925981745 2:9182624-9182646 CACAGAGCACAGAAAGAGCAGGG - Intergenic
927489220 2:23509735-23509757 AATACAGCAAAGCCTGAGCTTGG + Intronic
928446109 2:31334781-31334803 GAGACAGAAGAGACAGAGCTAGG + Exonic
929758612 2:44788053-44788075 CACACACCAAAGACAGACCTAGG - Intergenic
929924363 2:46196539-46196561 AATACAGGAGAGCCAGAGCTGGG + Intergenic
930879022 2:56251061-56251083 CATACAGCACAGACAACACTAGG - Intronic
933306560 2:80607424-80607446 CATCAAGCACACACAGAGCTTGG - Intronic
933389379 2:81651458-81651480 GATATAGCAGAGAGAGAGCTTGG + Intergenic
934118061 2:88814228-88814250 CATACAGCACAAGCAGAGTTAGG + Intergenic
935048462 2:99502953-99502975 GATATAGCAGAGAGAGAGCTTGG - Intergenic
936224999 2:110640720-110640742 CATGCAGCAAAGAGACAGCTTGG - Intronic
936718891 2:115224960-115224982 CACACAGTACTGCCAGAGCTAGG + Intronic
938427067 2:131201505-131201527 CACACAGCAGAGACAGGGTTGGG - Intronic
938468013 2:131535551-131535573 CACACAGCAGAGCCAGGGCTGGG - Intergenic
938538562 2:132266035-132266057 GAGACAGAACAGACAGGGCTCGG + Intergenic
938805867 2:134806845-134806867 TATACATCACAGAGAGAGCAGGG - Intergenic
939515382 2:143160876-143160898 CATACTTCAAAGAAAGAGCTAGG + Intronic
941190341 2:162373662-162373684 CCTACAGAACAGACAGAAGTAGG + Exonic
943425121 2:187721954-187721976 CATACTGAACAGACAAAACTTGG - Intergenic
944641310 2:201728571-201728593 CATGCTGCAGAGACAGGGCTCGG + Exonic
945023274 2:205595305-205595327 CATAAAGCAAAGGCAGAGCCTGG + Intronic
945744127 2:213699817-213699839 CAAACAGCACAGACAAAGCAGGG - Intronic
947318398 2:228889939-228889961 GACACAGCCCACACAGAGCTGGG + Intronic
947868495 2:233418666-233418688 CCCACAGCACAGTCAGAGCAAGG - Intronic
948508339 2:238446396-238446418 CACACGGCACAGACACAGCAAGG - Exonic
1168824288 20:798982-799004 GATATAGCAGAGAGAGAGCTTGG - Intergenic
1168885290 20:1247575-1247597 CATACAGCATAGGCAGGCCTAGG + Intronic
1169527677 20:6447987-6448009 CATACACCACTCACAGAACTGGG + Intergenic
1171867466 20:30497833-30497855 GAGACAGAACAGACAGGGCTCGG + Intergenic
1173562007 20:44012910-44012932 CATGCTGCACACACAGGGCTAGG + Intronic
1174189235 20:48728486-48728508 CATTCAGCTCAGCTAGAGCTGGG - Intronic
1174656435 20:52176031-52176053 CAATCAGCAAAGGCAGAGCTGGG - Intronic
1179381722 21:40905534-40905556 CATACAGAGAATACAGAGCTAGG + Intergenic
1180536825 22:16400566-16400588 GATACAGCAAAGGCAGTGCTAGG + Intergenic
1182805690 22:33068342-33068364 CATTCAAGACAGACAGAGTTGGG + Intergenic
1183422384 22:37719401-37719423 CACACAGCACAGCCAGCGCTGGG - Intronic
1183428845 22:37753798-37753820 CCAACAGCACAGACAGGGCTTGG + Intronic
1184064084 22:42106022-42106044 GATAGAGCAAAGAGAGAGCTTGG + Intergenic
1184627163 22:45744302-45744324 CAGACAACACAGACACAGTTGGG - Intronic
949433927 3:4007756-4007778 CAAGCAGAACAGGCAGAGCTGGG + Intronic
949869530 3:8576284-8576306 AATACAGCACAGGCAACGCTTGG - Intergenic
950594196 3:13964596-13964618 GATATAGCAGAGAGAGAGCTTGG + Intronic
952046236 3:29324508-29324530 CATGCAGCACAGAAAGACCCAGG - Intronic
952453359 3:33451212-33451234 TATACGTCACAGAGAGAGCTGGG + Intergenic
952846929 3:37695643-37695665 CACACATCACAGGCAGAGCATGG - Intronic
954135890 3:48581951-48581973 CAAACAGGACAGATACAGCTTGG + Intronic
954232030 3:49225149-49225171 TATACATCACAGAGAGAGCAGGG - Intronic
954862109 3:53699499-53699521 AACACAGCAGTGACAGAGCTAGG + Intronic
955351076 3:58193499-58193521 CAGACAGCAAACACAGACCTTGG - Intronic
957282542 3:78172095-78172117 CATATAGCACACATAAAGCTGGG + Intergenic
959537036 3:107498105-107498127 CCTTCAGCACAGCCAGAGTTTGG - Intergenic
960619995 3:119628233-119628255 CATGAAGCGCAGACAGAGTTGGG - Intronic
961377700 3:126477202-126477224 CAAACAGATCAGACAGAGGTGGG - Intergenic
961782484 3:129328786-129328808 CAAGCAGCACAGTCAGACCTGGG + Intergenic
962596855 3:136955007-136955029 GATACAGCCCAGGCAGAGGTGGG + Intronic
962929860 3:140026376-140026398 CACACAGCACAGAAAGGGCTTGG - Intronic
963697059 3:148575388-148575410 TATACATCACAGAGAGAGCAGGG + Intergenic
963991976 3:151666382-151666404 TATACATCACAGAGAGAGCAGGG - Intergenic
964408404 3:156373913-156373935 CACACAGGACAGACACAGTTGGG - Intronic
965622726 3:170656840-170656862 CCCAGAGCACAGAGAGAGCTGGG + Intronic
966588847 3:181657310-181657332 CATACACCAAACACAGTGCTAGG - Intergenic
967418958 3:189252354-189252376 CATTCACCAGAGACAGAACTAGG + Intronic
972243063 4:37214914-37214936 CATCCAGTTCAGTCAGAGCTTGG + Intergenic
974174822 4:58308927-58308949 TATACATCACAGAGAGAGCTAGG + Intergenic
974537434 4:63189208-63189230 TATACATCACAGAGAGAGCAGGG + Intergenic
975911815 4:79276400-79276422 GATATAGCAGAGAGAGAGCTTGG - Intronic
976146880 4:82050864-82050886 CATCCAGGACAGCCAGAGCAGGG - Intergenic
976912007 4:90319049-90319071 GATAAGGCACAGACAAAGCTGGG - Intronic
977609180 4:99014983-99015005 GATATAGCAGAGAGAGAGCTTGG + Intronic
979582353 4:122375819-122375841 CACAGAGGACAGACAGAGCTAGG - Intergenic
982701436 4:158662557-158662579 TATACATCACAGAGAGAGCAGGG + Intergenic
983708482 4:170687115-170687137 GATATAGCAGAGAGAGAGCTTGG - Intergenic
984839336 4:184053440-184053462 GATACGGGACACACAGAGCTTGG - Intergenic
987170657 5:15254016-15254038 CATTCAGAAGAGGCAGAGCTGGG - Intergenic
988704544 5:33711503-33711525 CACACAGCACAAACAGATTTTGG + Intronic
989496488 5:42115436-42115458 TATACATCACAGAGAGAGCAGGG + Intergenic
989957646 5:50374911-50374933 TATACATCACAGAGAGAGCTGGG + Intergenic
991170483 5:63619334-63619356 CATACAGCACATGCAGAGCTGGG + Intergenic
992085804 5:73277467-73277489 CAGACAGCACACCCAGACCTGGG + Intergenic
993917307 5:93758732-93758754 AATACAGCAAAGGCAGTGCTAGG + Intronic
994536920 5:101043024-101043046 CAAGAGGCACAGACAGAGCTGGG - Intergenic
995332877 5:110965216-110965238 CATAGAGCAAAGACAGAGACTGG + Intergenic
995583111 5:113621229-113621251 TATACATCACAGAGAGAGCAGGG - Intergenic
995706730 5:114994961-114994983 TATACATCACAGAGAGAGCAGGG + Intergenic
996637678 5:125714007-125714029 CAGCCAGCATAGACAGAGCCAGG - Intergenic
997072565 5:130637228-130637250 TATACATCACAGAGAGAGCAGGG + Intergenic
997591514 5:135075996-135076018 CATTCAGCCCAGCCACAGCTTGG - Intronic
998111767 5:139507900-139507922 TATACATCACAGAGAGAGCAGGG + Intergenic
998938532 5:147256300-147256322 GATATAGCAGAGAGAGAGCTTGG + Intronic
999877212 5:155820919-155820941 CATAGACCACAGAGAGAGCATGG + Intergenic
1000210263 5:159101360-159101382 CATATGGCAGAGACAGAGTTAGG - Intergenic
1000442813 5:161283367-161283389 CATACAGCACATGCAGAGCTTGG - Intergenic
1001558396 5:172652212-172652234 GATATAGCAGAGAGAGAGCTTGG + Intronic
1002961986 6:1923891-1923913 CATAGGTTACAGACAGAGCTGGG - Intronic
1003451130 6:6232940-6232962 GATACAGCAAAGGCAGTGCTAGG + Intronic
1003637417 6:7845403-7845425 CACCCTGCACAGACATAGCTGGG - Intronic
1003668910 6:8137547-8137569 CATAGAGCAAAGACAGAACCTGG - Intergenic
1004084102 6:12427306-12427328 CATGAAGCAAAGAAAGAGCTTGG - Intergenic
1004739972 6:18450152-18450174 CATCCAGCACAGACAAGTCTGGG - Intronic
1006325728 6:33352399-33352421 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1006844345 6:37051948-37051970 CAGCCAGCAGAGACAGGGCTGGG - Intergenic
1007724716 6:43908251-43908273 CACACAGCAGAGCCAGGGCTGGG - Intergenic
1008444967 6:51578063-51578085 CAAACAGCAGACACAGTGCTGGG + Intergenic
1011211894 6:84964435-84964457 GATACAGCAGAGAGACAGCTTGG + Intergenic
1011570469 6:88729064-88729086 CATATAGCAGAGAGCGAGCTTGG - Intronic
1011651141 6:89507557-89507579 CAGACAGAACAAACAGAGCACGG + Intronic
1012738076 6:102976341-102976363 GATACAGCAAAGATAGTGCTAGG + Intergenic
1014795460 6:125719459-125719481 AAAATAGCACAGACAGACCTGGG - Intergenic
1015086993 6:129307273-129307295 CTTACAGCCCAGAGAAAGCTTGG - Intronic
1017936005 6:159005899-159005921 CATAAAGCACAAACACAGCGTGG - Intergenic
1018095377 6:160383058-160383080 CCTAATGCACAGGCAGAGCTTGG - Intronic
1018937994 6:168286292-168286314 CCTTCAGCACAGCCTGAGCTCGG + Intergenic
1019014613 6:168870928-168870950 CAAACAGCACGGACACAGCCTGG - Intergenic
1019179616 6:170178107-170178129 CTTTGAGCACAGACAGACCTGGG - Intergenic
1019587834 7:1814551-1814573 CACACAGCCCCGCCAGAGCTGGG - Intergenic
1020655834 7:10927160-10927182 GATATAGCAGAGAGAGAGCTTGG - Intergenic
1020887646 7:13838566-13838588 TATACATTACAGACAGATCTGGG - Intergenic
1023799595 7:43822367-43822389 GATATAGCAGAGAGAGAGCTTGG - Intergenic
1024148306 7:46539972-46539994 CATACAGGACAACCAAAGCTGGG - Intergenic
1024696694 7:51864965-51864987 CATACAGAAAACACAAAGCTAGG + Intergenic
1024870492 7:53958132-53958154 TATACATCACAGAGAGAGCAGGG - Intergenic
1025933208 7:66012908-66012930 CATACATGAGAGAAAGAGCTAGG + Intergenic
1027641554 7:80739740-80739762 CAAACAACACAGACATATCTTGG + Intergenic
1027808199 7:82856977-82856999 CATACAACACAGAGAGAGTAAGG - Intronic
1028018008 7:85739146-85739168 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1029296388 7:99543613-99543635 CATAGACCACGGACAGAGCCTGG - Intergenic
1029459607 7:100687305-100687327 AATCCAGCGCAGCCAGAGCTGGG - Exonic
1031075470 7:117208329-117208351 CATACTCCACAGAAAGACCTGGG - Intronic
1032045467 7:128603648-128603670 TATCCAGCACAGACAGACCCGGG + Intergenic
1032045971 7:128608192-128608214 CATCCAGCACAGACAGACCCAGG + Intergenic
1034192878 7:149224798-149224820 CATTCAGACCAGACAGATCTGGG - Exonic
1034579671 7:152031691-152031713 TATACATCACAGAGAGAGCAGGG - Intronic
1034626196 7:152494672-152494694 CACTGAGCACAGCCAGAGCTGGG + Intergenic
1035136298 7:156706717-156706739 GATACAGCAAAAACAGTGCTAGG + Intronic
1035570966 8:671894-671916 CAGTGAGCACAGACAGAGCCGGG - Intronic
1035631269 8:1108245-1108267 CATTCAGCACATACTGAGTTTGG - Intergenic
1035631656 8:1111292-1111314 CCTTCAGCACACACAGTGCTGGG - Intergenic
1036597287 8:10225372-10225394 CTTAGAGCACAGGCAGAGATGGG - Intronic
1036633389 8:10531005-10531027 AATACAGCAAAGGCCGAGCTGGG - Intronic
1036959762 8:13231081-13231103 CATACAGCACAGACAAAAGTGGG + Intronic
1038408560 8:27340917-27340939 CAGACAGAACAGACAGGGCTTGG + Intronic
1039896026 8:41717099-41717121 AAAACGGCACACACAGAGCTAGG + Intronic
1040649225 8:49430734-49430756 TATACATCACAGAGAGAGCAGGG + Intergenic
1040733718 8:50481090-50481112 CATACAGCACAGGCTGGGCGCGG + Intronic
1040964770 8:53072519-53072541 TATACATCACAGAGAGAGCAGGG - Intergenic
1042087795 8:65127805-65127827 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG + Intronic
1042919902 8:73910577-73910599 TATACATCACAGAGAGAGCAGGG + Intergenic
1044245682 8:89942149-89942171 CTTACAACACAGAAGGAGCTAGG + Intronic
1045667997 8:104511834-104511856 CATACAGCACAGATATATCAAGG + Intronic
1048376549 8:133827591-133827613 CTTAAAGCAGAGAAAGAGCTAGG + Intergenic
1050319717 9:4439106-4439128 CATGCAGCACAGAGAGAGAAAGG - Intergenic
1050995567 9:12212981-12213003 CATCCAGCACACACAGAGGCAGG - Intergenic
1052057489 9:23921294-23921316 TATACATCACAGAGAGAGCAGGG - Intergenic
1055623476 9:78149814-78149836 CATTCAGCACAGACAGAGTCTGG + Intergenic
1056392486 9:86152706-86152728 TATACATCACAGAGAGAGCAGGG - Intergenic
1056599941 9:88038979-88039001 GATAGAGCAGAGAGAGAGCTTGG + Intergenic
1056688199 9:88783978-88784000 AATACAGCACACCCAGTGCTGGG + Intergenic
1057255230 9:93541023-93541045 CATACCCCACACACAGAGCATGG - Intronic
1057485273 9:95477925-95477947 CATCCAGGACAGAGAGAGCGTGG - Intronic
1058561857 9:106238741-106238763 CATGCAGGAAAGACAGAGTTTGG - Intergenic
1059325419 9:113501408-113501430 CACACAGCACAGACAGGGCTTGG + Intronic
1061223706 9:129267656-129267678 CAGACACCACATAGAGAGCTGGG - Intergenic
1062071209 9:134555909-134555931 CATAGAGCTCAGACACTGCTGGG - Intergenic
1203362449 Un_KI270442v1:228806-228828 GAGACAGAACAGACAGGGCTCGG + Intergenic
1185661874 X:1734912-1734934 CAGTCAGGAAAGACAGAGCTCGG - Intergenic
1186219422 X:7333815-7333837 GATAATGCACGGACAGAGCTGGG + Intronic
1186262049 X:7790332-7790354 CATAGAGCAAGGACAGAGCAAGG - Intergenic
1187586137 X:20663894-20663916 CATAAAGGACAGACATAGCAGGG + Intergenic
1189218944 X:39354105-39354127 GATACAGCAAAAACAGTGCTAGG - Intergenic
1189390889 X:40575665-40575687 CATAAAGTACAGACAGGGCCGGG + Intergenic
1190565482 X:51726354-51726376 CAAATATCACAGATAGAGCTAGG - Intergenic
1190744947 X:53316980-53317002 CCTACAGCAGAGCCGGAGCTGGG + Intronic
1191889869 X:65928845-65928867 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1193717375 X:84948745-84948767 GATATAGCAGAGAGAGAGCTTGG - Intergenic
1193808445 X:86022276-86022298 CAGACATGACAGATAGAGCTGGG + Intronic
1194466387 X:94239237-94239259 GATACAGCAAAGGCAGTGCTAGG + Intergenic
1195846761 X:109237492-109237514 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1195850869 X:109280363-109280385 TATACATCACAGAGAGAGCAGGG - Intergenic
1198742525 X:139856244-139856266 GATATAGCAGAGAGAGAGCTTGG - Intronic
1199832111 X:151557641-151557663 TATACATCACAGAGAGAGCCGGG - Intergenic
1200752274 Y:6957316-6957338 GATATAGCAGAGAGAGAGCTTGG - Intronic
1201296800 Y:12470634-12470656 GATATAGCAGAGAGAGAGCTTGG + Intergenic
1201429973 Y:13893503-13893525 TATACATCACAGAGAGAGCAGGG + Intergenic
1201487854 Y:14510896-14510918 TATACATCACAGAGAGAGCCGGG + Intergenic
1201556024 Y:15265284-15265306 TATACATCACAGAGAGAGCTGGG + Intergenic
1202379412 Y:24262474-24262496 GATAAAGCATAGACAGAGCCAGG + Intergenic
1202491370 Y:25407647-25407669 GATAAAGCATAGACAGAGCCAGG - Intergenic