ID: 1135044009

View in Genome Browser
Species Human (GRCh38)
Location 16:19139907-19139929
Sequence GTGAATAAACTGAGGTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135044009_1135044017 22 Left 1135044009 16:19139907-19139929 CCTCTGAACCTCAGTTTATTCAC No data
Right 1135044017 16:19139952-19139974 CCTAACCTCAGAGGGTGTTATGG No data
1135044009_1135044018 23 Left 1135044009 16:19139907-19139929 CCTCTGAACCTCAGTTTATTCAC No data
Right 1135044018 16:19139953-19139975 CTAACCTCAGAGGGTGTTATGGG No data
1135044009_1135044020 30 Left 1135044009 16:19139907-19139929 CCTCTGAACCTCAGTTTATTCAC No data
Right 1135044020 16:19139960-19139982 CAGAGGGTGTTATGGGAATTCGG 0: 1
1: 0
2: 1
3: 15
4: 183
1135044009_1135044015 14 Left 1135044009 16:19139907-19139929 CCTCTGAACCTCAGTTTATTCAC No data
Right 1135044015 16:19139944-19139966 GATTATAGCCTAACCTCAGAGGG No data
1135044009_1135044014 13 Left 1135044009 16:19139907-19139929 CCTCTGAACCTCAGTTTATTCAC No data
Right 1135044014 16:19139943-19139965 AGATTATAGCCTAACCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135044009 Original CRISPR GTGAATAAACTGAGGTTCAG AGG (reversed) Intronic
No off target data available for this crispr