ID: 1135044018

View in Genome Browser
Species Human (GRCh38)
Location 16:19139953-19139975
Sequence CTAACCTCAGAGGGTGTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135044010_1135044018 15 Left 1135044010 16:19139915-19139937 CCTCAGTTTATTCACCTGCAAAA No data
Right 1135044018 16:19139953-19139975 CTAACCTCAGAGGGTGTTATGGG No data
1135044009_1135044018 23 Left 1135044009 16:19139907-19139929 CCTCTGAACCTCAGTTTATTCAC No data
Right 1135044018 16:19139953-19139975 CTAACCTCAGAGGGTGTTATGGG No data
1135044013_1135044018 1 Left 1135044013 16:19139929-19139951 CCTGCAAAATGGGTAGATTATAG No data
Right 1135044018 16:19139953-19139975 CTAACCTCAGAGGGTGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135044018 Original CRISPR CTAACCTCAGAGGGTGTTAT GGG Intronic
No off target data available for this crispr