ID: 1135044020

View in Genome Browser
Species Human (GRCh38)
Location 16:19139960-19139982
Sequence CAGAGGGTGTTATGGGAATT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135044010_1135044020 22 Left 1135044010 16:19139915-19139937 CCTCAGTTTATTCACCTGCAAAA No data
Right 1135044020 16:19139960-19139982 CAGAGGGTGTTATGGGAATTCGG 0: 1
1: 0
2: 1
3: 15
4: 183
1135044013_1135044020 8 Left 1135044013 16:19139929-19139951 CCTGCAAAATGGGTAGATTATAG No data
Right 1135044020 16:19139960-19139982 CAGAGGGTGTTATGGGAATTCGG 0: 1
1: 0
2: 1
3: 15
4: 183
1135044009_1135044020 30 Left 1135044009 16:19139907-19139929 CCTCTGAACCTCAGTTTATTCAC No data
Right 1135044020 16:19139960-19139982 CAGAGGGTGTTATGGGAATTCGG 0: 1
1: 0
2: 1
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135044020 Original CRISPR CAGAGGGTGTTATGGGAATT CGG Intronic
901591116 1:10344023-10344045 CACAGGGTGGGGTGGGAATTTGG - Intronic
904196098 1:28786587-28786609 CCCAGGCTGTTCTGGGAATTGGG + Intergenic
904343574 1:29853656-29853678 CAGAGGGTAGTCTGGGATTTTGG - Intergenic
904925680 1:34046143-34046165 TAGTTGGTGTGATGGGAATTAGG + Intronic
906669969 1:47647336-47647358 CAGAGCCTGTATTGGGAATTAGG + Intergenic
906953501 1:50353069-50353091 TTGAGAGTGTTATGGGTATTGGG + Intergenic
908057420 1:60304644-60304666 CAGAGGGTGTTGAGGAAAATAGG - Intergenic
908466960 1:64405803-64405825 CTGAGGGTGTTTCTGGAATTTGG - Intergenic
909182791 1:72446471-72446493 CAGTGGGGGCTATGGGGATTTGG + Intergenic
911273153 1:95828061-95828083 CAAAGAGTGACATGGGAATTTGG - Intergenic
914798575 1:150942476-150942498 AAGAGGGTAGTATGGTAATTAGG - Intronic
916093441 1:161327401-161327423 CATATGTTGTTATGGGTATTGGG + Intronic
917258983 1:173147429-173147451 CAGAGGGGGTTATGTTAATGAGG + Intergenic
918025882 1:180745543-180745565 CACAGGGTTTCATGGGAGTTTGG + Intronic
921083929 1:211769438-211769460 GAGAGAGTGTTATGGGAAAGGGG + Intronic
921280101 1:213557952-213557974 CAGAGAAGGTTAGGGGAATTAGG - Intergenic
921632581 1:217453841-217453863 CAGAGGCTGTTCAGAGAATTAGG + Intronic
922126013 1:222724607-222724629 CAGGAGATGTGATGGGAATTAGG + Intronic
924312738 1:242762367-242762389 CAGAGGCAGATATGAGAATTTGG + Intergenic
1063761750 10:9086468-9086490 CTGAGTATGTTATGGGAAGTTGG + Intergenic
1065078229 10:22102183-22102205 CAGAGCGTTTAATGGGACTTTGG + Intergenic
1065139131 10:22703546-22703568 AAGAGGGTGTTATGGGATGAGGG + Intronic
1065484833 10:26227638-26227660 GAGAGGGTGCTATGGGCATCTGG + Intronic
1066017778 10:31265218-31265240 CAGAGGGTCTCATGAGATTTAGG - Intergenic
1072029116 10:91500144-91500166 CAGGAGGTGTTATGGGATATTGG + Intronic
1073044220 10:100626976-100626998 CAGAGGGTGTTGGGGGAAAAGGG + Intergenic
1074265151 10:111894296-111894318 CAGTAAGTGTTATGGGAGTTAGG + Intergenic
1074922270 10:118027546-118027568 CAGAGCCTGGTATGGGAATGGGG - Intronic
1075312333 10:121424919-121424941 TGGAGGGTGAGATGGGAATTGGG + Intergenic
1075960341 10:126562830-126562852 CAGATGGGGTTATGTGCATTTGG - Intronic
1077872891 11:6278305-6278327 CAGAGGCTGTGAAGGGTATTGGG + Intergenic
1079345700 11:19650303-19650325 CAGAGGCAGGTATGGGAGTTAGG + Intronic
1080101242 11:28462235-28462257 GAAAGGGTGTTATGGGAATAAGG + Intergenic
1081928450 11:46850268-46850290 GAGAGGGTGTGATGGTAATCAGG + Intergenic
1084358518 11:68654540-68654562 CAGAGGGTGTAGTGGGAAGTGGG - Intergenic
1088160786 11:106867977-106867999 CAGAGGGTTTTTTGGGGGTTGGG - Intronic
1088410941 11:109533853-109533875 CTGAGGAGGTGATGGGAATTAGG - Intergenic
1092306397 12:7305509-7305531 CCCAGGTTGTTATGGGGATTTGG - Intronic
1093727018 12:22525286-22525308 CACAGGCTTTTATGGGTATTGGG - Intronic
1095039259 12:37423616-37423638 TAGAGGGCGTTATGGGAGTGGGG + Intergenic
1095260190 12:40089146-40089168 CAGAGGGTGCTAGGGGCATATGG + Intronic
1098535104 12:71585126-71585148 AAGAGGTTGTTGGGGGAATTAGG + Exonic
1099186363 12:79519839-79519861 CAGAGGATGCTATGGGAATAGGG + Intergenic
1099736622 12:86575362-86575384 CAGAGGCTGTGAAGGGTATTGGG - Intronic
1103660572 12:122512312-122512334 CAGAGGGCGTTAGTGGCATTTGG - Intronic
1107211345 13:37858773-37858795 CAGAGGCTGGTATGGGTAATGGG + Intronic
1107213289 13:37884985-37885007 CAGAGGGTACAATGGGAATGAGG + Intergenic
1112963545 13:105158868-105158890 CAGTGGCCGTAATGGGAATTAGG - Intergenic
1114062329 14:19029472-19029494 CAGGGGGTGTTGTGGGAAGGTGG - Intergenic
1114099930 14:19370521-19370543 CAGGGGGTGTTGTGGGAAGGTGG + Intergenic
1114129323 14:19771682-19771704 CAGTGGGTGTCATGGGATCTGGG + Intronic
1114277141 14:21156874-21156896 CAGAGGATGTTATGGCCAGTAGG + Intergenic
1114632664 14:24169494-24169516 CAGAGGTCCTTATGGGGATTTGG - Intergenic
1115115719 14:29879187-29879209 CACAGGGTGTTTTAGGAATGAGG - Intronic
1115749787 14:36477635-36477657 CAGAAGGTGTTATGGCAAACAGG + Intronic
1116790963 14:49339489-49339511 CACAGGGTGTTGTGGGCATTTGG - Intergenic
1116859274 14:49980687-49980709 AGGAGGGTGTTATGGGAGTCTGG + Intergenic
1117280001 14:54230363-54230385 CAGAGGGTGATGTAGGATTTGGG + Intergenic
1117333091 14:54733849-54733871 CAGAGGGTCATATGGACATTCGG - Intronic
1118766730 14:68915125-68915147 CAGAGGGTGATATGGGGTCTGGG - Intronic
1118789919 14:69081224-69081246 CTCAGGGTGTTTTGGGAAATGGG - Intronic
1118919336 14:70135735-70135757 CAGAGGCTGGTAAGGGAAGTGGG + Intronic
1119732065 14:76957233-76957255 CAGAGGGTGGGATGGGAGCTGGG - Intergenic
1126358005 15:47816601-47816623 CAGAGGGGATTGTGGGAATCAGG + Intergenic
1133867582 16:9658500-9658522 GGGAGGGTGTGATGGGCATTTGG + Intergenic
1134817006 16:17214071-17214093 GAGAGGCTGTTATGGGGACTAGG - Intronic
1135044020 16:19139960-19139982 CAGAGGGTGTTATGGGAATTCGG + Intronic
1137690589 16:50424324-50424346 CAGAGTGTTTTAAGAGAATTTGG - Intergenic
1139563610 16:67759122-67759144 CAGAGGGTGGTTTGGTATTTGGG - Intronic
1139746993 16:69082801-69082823 CAGAGGGCTTTATGGGGATCTGG + Intronic
1139958836 16:70706147-70706169 CAGAGGGTGTCATGGGGCATGGG + Intronic
1140458095 16:75116191-75116213 CAGAGCTTGATAAGGGAATTAGG + Intronic
1141604807 16:85146709-85146731 CAGGGGTTGGGATGGGAATTGGG + Intergenic
1142686062 17:1577508-1577530 CAGGGGCTGTTGCGGGAATTGGG + Intronic
1147745783 17:42693570-42693592 CATAGGGTGTAATGGGATGTAGG + Intronic
1147777627 17:42914030-42914052 CAGAGGGCGTTGTGGGAACCAGG + Intergenic
1148261433 17:46187104-46187126 CAGAGGGTGTGAAGGGAAAGAGG - Intronic
1149056206 17:52369333-52369355 CAGAGGGTGTTCTGGAGACTGGG + Intergenic
1150337968 17:64343870-64343892 CAGAGGGTGTCTTGGGGATGTGG - Intronic
1151254902 17:72869098-72869120 CAGAGGTTCTTCTGGGAATAAGG + Intronic
1153984286 18:10339255-10339277 CTGAGGGAGTTCTTGGAATTGGG - Intergenic
1155311711 18:24530682-24530704 CAGAAGGTGTTAGGGCATTTGGG + Intergenic
1155313164 18:24544869-24544891 TAGAGGATGTTGTGGGAGTTTGG + Intergenic
1158821876 18:61169554-61169576 CTGATGGTGTTATGGGTATTTGG - Intergenic
1161208632 19:3055265-3055287 TAGAGGGTGTTAGGGGATTGTGG - Intronic
1162941899 19:14015676-14015698 CAGAGAGTGTTATCGAACTTTGG - Intergenic
1163224841 19:15951877-15951899 CAGAGGCTGTTAAGGGTAGTTGG - Intergenic
926591428 2:14744182-14744204 CATAGTGTGTTTTGGGAAATTGG - Intergenic
926944321 2:18170516-18170538 AAGAGGCTGTTACAGGAATTTGG + Intronic
927171063 2:20370112-20370134 CATATATTGTTATGGGAATTGGG + Intergenic
927934501 2:27068668-27068690 CAGAGGCTGTCATGGTAATCGGG + Exonic
930008202 2:46914981-46915003 CAAAGGGTGATAAGGGAATGGGG + Intronic
930553374 2:52864587-52864609 CAGAGGAAGTGATGGAAATTTGG + Intergenic
932355259 2:71063112-71063134 CACAGGGTGTTGTGGCAATCTGG + Intergenic
932693094 2:73930148-73930170 CAGAGGGTGTGGTGGGAACTTGG + Intronic
933072445 2:77876836-77876858 CAGAGGGGTTTATGGGCTTTCGG + Intergenic
935838242 2:107078497-107078519 CAGAAGTTGATATGGGGATTTGG + Intergenic
936690908 2:114887390-114887412 CAAAGGATGTTTTGGGAATAAGG - Intronic
937043668 2:118839318-118839340 GAGAGGGTGTTGTGGTATTTGGG - Intergenic
938555051 2:132416612-132416634 GAGAGGGTGCTCTGGGAATGTGG + Exonic
939419374 2:141946135-141946157 CAGAGAGTGATAAGAGAATTGGG - Intronic
944338914 2:198571607-198571629 CAGAGGGAGTTAAAGGAAATTGG + Intronic
945199673 2:207268496-207268518 CACACGGTGTTCTGGGAGTTGGG - Intergenic
945222154 2:207495346-207495368 CACAGAGTGCTATGGCAATTGGG + Intergenic
945511379 2:210707055-210707077 CAGAGGGTGTGAGGAAAATTGGG - Intergenic
946408257 2:219504016-219504038 CAGAGGGTCTTAGGGGACTGTGG + Intronic
948137866 2:235650343-235650365 CAGAGTGAGTTCTGGGAGTTGGG + Intronic
948998269 2:241595787-241595809 CAGAGGGTGACATGAGAATCTGG + Intronic
1169371323 20:5030471-5030493 CAGAGGGATTGATGGGAACTAGG + Intergenic
1169512093 20:6275433-6275455 GAGAAGTTGTGATGGGAATTAGG - Intergenic
1169954465 20:11085547-11085569 GAGAGGCGGTTATGGTAATTTGG - Intergenic
1170076808 20:12428455-12428477 CAGGGGATTTTATGGGAATCAGG + Intergenic
1172092354 20:32442631-32442653 TAGGGATTGTTATGGGAATTTGG + Intergenic
1173391861 20:42642575-42642597 CGGAGGCTGTTATGAGGATTAGG - Intronic
1175235727 20:57509756-57509778 AAGAGGGTGTTTAGTGAATTGGG - Intronic
1175824608 20:61930220-61930242 CAGAGAGTGTCCTGGGACTTTGG - Intronic
1180480822 22:15752099-15752121 CAGGGGGTGTTGTGGGAAGGTGG - Intergenic
1181379258 22:22486957-22486979 CAGAGGCACTTCTGGGAATTCGG + Exonic
1184807006 22:46801864-46801886 GAGAGGGTGTTTTGGGGGTTGGG + Intronic
949764826 3:7515091-7515113 CAAAGAGTGTTGTGAGAATTAGG + Intronic
950206821 3:11087172-11087194 CAGAGGGTGGGCTGGGAATTGGG + Intergenic
955632794 3:60992659-60992681 CAGAGAGGGTTTTGGGAAGTTGG - Intronic
956793190 3:72695538-72695560 CAGAGCGTTTTAAGGAAATTGGG - Intergenic
957274761 3:78076544-78076566 CAGAGGTTGGGAGGGGAATTAGG + Intergenic
957624584 3:82642086-82642108 GAAAGGGAGTCATGGGAATTGGG - Intergenic
957803539 3:85117662-85117684 TACAGGGTGTTATAGGGATTAGG + Intronic
958094245 3:88921668-88921690 CAGATGTTGTTCTGGGAAATCGG + Intergenic
960273413 3:115699319-115699341 CAGAGGGTGTTAGAGCAATATGG - Intronic
960744243 3:120868890-120868912 CAGAAGATGTTATGGAAAATAGG - Intergenic
961221511 3:125204566-125204588 CAGAGGGTGGGAAGGGGATTGGG + Intronic
961511770 3:127407859-127407881 GAGAGGGTGATATTGGAATGGGG + Intergenic
963823029 3:149920562-149920584 CAGAGGGTGTTTTTGGTATTTGG + Intronic
964295889 3:155232655-155232677 CACAGAGTGCTATGGAAATTTGG - Intergenic
965537634 3:169840373-169840395 GAGATAGTGTTATGGGAAATGGG - Intronic
967284406 3:187854211-187854233 CTGAGGGTTTTATGGGACTTAGG + Intergenic
968028739 3:195465023-195465045 GAGAGAGTGTTATGGGAACACGG - Intergenic
971690820 4:29833390-29833412 CAGAGGCTGAGAAGGGAATTGGG + Intergenic
973205279 4:47552896-47552918 CAGAGAGTTTAATGGGTATTAGG - Intronic
974723906 4:65774648-65774670 CATAGGGTGTTGTAGGCATTTGG + Intergenic
977411247 4:96668044-96668066 CAGTGGGTGTGTTGGGAAATGGG + Intergenic
978045781 4:104125324-104125346 CAGAGGCTGTTAAGGGTAGTGGG + Intergenic
978063863 4:104371781-104371803 CTGATGGTTTTATGGGCATTGGG - Intergenic
978770218 4:112448394-112448416 CAGAGTGTGCAATGGGAATGGGG - Intergenic
979270279 4:118751661-118751683 GGGAGGGTGATATGGGAATCTGG + Intronic
981024679 4:140065596-140065618 CAGAGTTTGTTGTGAGAATTTGG + Intronic
981833871 4:149031909-149031931 CAGATGGTGAGATGGGATTTTGG - Intergenic
982808669 4:159798996-159799018 CAGAGACAGATATGGGAATTAGG + Intergenic
984070775 4:175109499-175109521 GAGAGGGGGAGATGGGAATTGGG - Intergenic
984078916 4:175217812-175217834 CAGACAGTGTTTTGGGTATTGGG + Intergenic
984397694 4:179222370-179222392 TCGAGGGTGTTATGGGGATCAGG + Intergenic
984825065 4:183916839-183916861 AAGAGGGTGTTATTGGAAAGGGG - Intronic
987137149 5:14910957-14910979 GAGTGGGGGTTATGGGAATTTGG + Intergenic
990042510 5:51390466-51390488 CAGAGGGTGATCTGGGCATGCGG - Intronic
991168756 5:63595052-63595074 CAGAGGGTGTTGTGGGGAGAAGG + Intergenic
991662406 5:68963250-68963272 AAGAGGGTTTTATGGGATTTGGG - Intergenic
995282731 5:110353939-110353961 AAGAGGGTGTTGTGGGTGTTTGG - Intronic
996209173 5:120783869-120783891 CAGAGGCTGGTATGGGTAGTGGG - Intergenic
996489727 5:124079251-124079273 CAGAGGGTAATTTGAGAATTTGG - Intergenic
997199058 5:131998716-131998738 GAGAGGGTGGTATGGGAGTCTGG - Intronic
1007266448 6:40599864-40599886 CAGAGGTTGTGAGGGGAATGGGG + Intergenic
1008131570 6:47725301-47725323 CAGAGGAAGTTGTGGGAATTGGG - Intergenic
1010939919 6:81904729-81904751 CAGAGGGTATTATAGGAAGCTGG + Intergenic
1014433986 6:121401040-121401062 TGGAGGGTGGCATGGGAATTGGG + Intergenic
1015179037 6:130342173-130342195 CAGAGGGTCTTTTGAGAATCTGG - Intronic
1016309882 6:142723029-142723051 CAGAGTGGGTTCTGGTAATTCGG + Intergenic
1017678706 6:156841740-156841762 CAGAGGCTGTTATGAGGACTGGG - Intronic
1018884447 6:167921645-167921667 CAGAGCTTGTTATGGAAATGCGG + Intronic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1019936517 7:4261735-4261757 CAGAGGGTATCAAGGGAACTGGG - Intronic
1024970530 7:55065682-55065704 CAGAAGGTGTTGGGGGAATTAGG + Intronic
1025285323 7:57655694-57655716 TAGAGGGCGTTATGGGAATGGGG + Intergenic
1028644969 7:93085853-93085875 GAGAGGGTATGATGGGAATAAGG + Intergenic
1028659064 7:93246923-93246945 AAAAAGGTATTATGGGAATTGGG - Intronic
1029225159 7:99021226-99021248 CAGAGTTTGTTATGCTAATTGGG - Intergenic
1029304075 7:99606121-99606143 CAAATGTTATTATGGGAATTTGG - Intronic
1029681992 7:102117714-102117736 AAGAGGGTGGTATGGGATTCGGG + Intronic
1031173539 7:118320709-118320731 AAGAGGGTATTCTGGGAAGTAGG - Intergenic
1037361842 8:18082844-18082866 TAGTTGGTTTTATGGGAATTGGG - Intronic
1040581518 8:48702395-48702417 GAGAGGGTGTTAGGGCAACTTGG - Intergenic
1043018228 8:74968186-74968208 CCAAGGGTGTTACTGGAATTAGG + Intergenic
1047454242 8:124994643-124994665 CATAGATTGTTATGGGTATTGGG - Intergenic
1048886003 8:138910487-138910509 CAGAGAGAGTTCTGGGAAGTGGG - Intronic
1049420590 8:142514804-142514826 GACAGGGTGTGATGGGAATTGGG + Intronic
1051556951 9:18394318-18394340 CAGATTCTGTTATTGGAATTAGG - Intergenic
1053480699 9:38414448-38414470 CAGATGGTGCTGGGGGAATTTGG - Intronic
1057800263 9:98186715-98186737 TATAGGTTGTTATGGGGATTGGG + Intronic
1059720122 9:116951635-116951657 GAGAGGGTGGTATTGGTATTTGG + Intronic
1062264859 9:135682302-135682324 TGGAGGGTGTTATGTGAATGAGG - Intergenic
1062707553 9:137953794-137953816 CAGAGGGTGTTGTGGGGAGAGGG + Intronic
1187107628 X:16260609-16260631 CAGGGTGTGCTATGGGAATGTGG + Intergenic
1187249172 X:17581450-17581472 CAGAGGGTGTTTTGGGCATTGGG + Intronic
1189231212 X:39453876-39453898 CAGATGGTTCTATGGGAATCGGG + Intergenic
1191114157 X:56834375-56834397 AAGAAGTTATTATGGGAATTGGG + Intergenic
1193869863 X:86783828-86783850 CAGAGGGTGATAAGGGTAGTGGG + Intronic
1196056883 X:111365626-111365648 CAGAGGCTGTTAAGGGTAGTGGG - Intronic
1196264046 X:113620394-113620416 CAGAGGCTGATATGGGCAGTTGG + Intergenic
1197853973 X:130895010-130895032 GAGAAGGTGTTCTGGGAATATGG - Intronic
1197876058 X:131108382-131108404 CAGAGGCTGTAAAGGGAAGTGGG - Intergenic
1198889047 X:141371888-141371910 CAAAAAGTGTTATGGGAATAAGG - Intergenic
1201448664 Y:14085364-14085386 CAGTGGGTATTTTGGTAATTAGG + Intergenic