ID: 1135044043

View in Genome Browser
Species Human (GRCh38)
Location 16:19140170-19140192
Sequence GAGCTGGGGGAGTGCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135044043_1135044051 -5 Left 1135044043 16:19140170-19140192 CCAGCCCTGCACTCCCCCAGCTC No data
Right 1135044051 16:19140188-19140210 AGCTCTCTGATCATCCTGAAGGG No data
1135044043_1135044055 23 Left 1135044043 16:19140170-19140192 CCAGCCCTGCACTCCCCCAGCTC No data
Right 1135044055 16:19140216-19140238 GAAAACAACCAGGGAAAAGCTGG No data
1135044043_1135044050 -6 Left 1135044043 16:19140170-19140192 CCAGCCCTGCACTCCCCCAGCTC No data
Right 1135044050 16:19140187-19140209 CAGCTCTCTGATCATCCTGAAGG No data
1135044043_1135044054 14 Left 1135044043 16:19140170-19140192 CCAGCCCTGCACTCCCCCAGCTC No data
Right 1135044054 16:19140207-19140229 AGGGCTGAAGAAAACAACCAGGG No data
1135044043_1135044053 13 Left 1135044043 16:19140170-19140192 CCAGCCCTGCACTCCCCCAGCTC No data
Right 1135044053 16:19140206-19140228 AAGGGCTGAAGAAAACAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135044043 Original CRISPR GAGCTGGGGGAGTGCAGGGC TGG (reversed) Intronic
No off target data available for this crispr