ID: 1135044045

View in Genome Browser
Species Human (GRCh38)
Location 16:19140175-19140197
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135044045_1135044054 9 Left 1135044045 16:19140175-19140197 CCTGCACTCCCCCAGCTCTCTGA No data
Right 1135044054 16:19140207-19140229 AGGGCTGAAGAAAACAACCAGGG No data
1135044045_1135044055 18 Left 1135044045 16:19140175-19140197 CCTGCACTCCCCCAGCTCTCTGA No data
Right 1135044055 16:19140216-19140238 GAAAACAACCAGGGAAAAGCTGG No data
1135044045_1135044053 8 Left 1135044045 16:19140175-19140197 CCTGCACTCCCCCAGCTCTCTGA No data
Right 1135044053 16:19140206-19140228 AAGGGCTGAAGAAAACAACCAGG No data
1135044045_1135044051 -10 Left 1135044045 16:19140175-19140197 CCTGCACTCCCCCAGCTCTCTGA No data
Right 1135044051 16:19140188-19140210 AGCTCTCTGATCATCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135044045 Original CRISPR TCAGAGAGCTGGGGGAGTGC AGG (reversed) Intronic
No off target data available for this crispr