ID: 1135044055

View in Genome Browser
Species Human (GRCh38)
Location 16:19140216-19140238
Sequence GAAAACAACCAGGGAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135044048_1135044055 8 Left 1135044048 16:19140185-19140207 CCCAGCTCTCTGATCATCCTGAA No data
Right 1135044055 16:19140216-19140238 GAAAACAACCAGGGAAAAGCTGG No data
1135044045_1135044055 18 Left 1135044045 16:19140175-19140197 CCTGCACTCCCCCAGCTCTCTGA No data
Right 1135044055 16:19140216-19140238 GAAAACAACCAGGGAAAAGCTGG No data
1135044046_1135044055 10 Left 1135044046 16:19140183-19140205 CCCCCAGCTCTCTGATCATCCTG No data
Right 1135044055 16:19140216-19140238 GAAAACAACCAGGGAAAAGCTGG No data
1135044047_1135044055 9 Left 1135044047 16:19140184-19140206 CCCCAGCTCTCTGATCATCCTGA No data
Right 1135044055 16:19140216-19140238 GAAAACAACCAGGGAAAAGCTGG No data
1135044041_1135044055 25 Left 1135044041 16:19140168-19140190 CCCCAGCCCTGCACTCCCCCAGC No data
Right 1135044055 16:19140216-19140238 GAAAACAACCAGGGAAAAGCTGG No data
1135044044_1135044055 19 Left 1135044044 16:19140174-19140196 CCCTGCACTCCCCCAGCTCTCTG No data
Right 1135044055 16:19140216-19140238 GAAAACAACCAGGGAAAAGCTGG No data
1135044049_1135044055 7 Left 1135044049 16:19140186-19140208 CCAGCTCTCTGATCATCCTGAAG No data
Right 1135044055 16:19140216-19140238 GAAAACAACCAGGGAAAAGCTGG No data
1135044042_1135044055 24 Left 1135044042 16:19140169-19140191 CCCAGCCCTGCACTCCCCCAGCT No data
Right 1135044055 16:19140216-19140238 GAAAACAACCAGGGAAAAGCTGG No data
1135044052_1135044055 -9 Left 1135044052 16:19140202-19140224 CCTGAAGGGCTGAAGAAAACAAC No data
Right 1135044055 16:19140216-19140238 GAAAACAACCAGGGAAAAGCTGG No data
1135044043_1135044055 23 Left 1135044043 16:19140170-19140192 CCAGCCCTGCACTCCCCCAGCTC No data
Right 1135044055 16:19140216-19140238 GAAAACAACCAGGGAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135044055 Original CRISPR GAAAACAACCAGGGAAAAGC TGG Intronic
No off target data available for this crispr