ID: 1135044059

View in Genome Browser
Species Human (GRCh38)
Location 16:19140256-19140278
Sequence GGCCCTCTGGTCATTTCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135044059_1135044066 1 Left 1135044059 16:19140256-19140278 CCCTTCGAAATGACCAGAGGGCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1135044066 16:19140280-19140302 CAGGCATGAGCTGTCTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135044059 Original CRISPR GGCCCTCTGGTCATTTCGAA GGG (reversed) Intronic
909467716 1:75991857-75991879 GTCTCTCTCGTCATTTAGAAAGG + Intergenic
913408125 1:118518541-118518563 GGCTCTCTGGTCAGTTCCATTGG + Intergenic
916971923 1:170029390-170029412 GGCCCTTGGGTTATTTAGAAGGG - Intronic
922713893 1:227855971-227855993 GGCCCTGTGGCCATTTTCAAGGG - Intergenic
1063275617 10:4564117-4564139 GGCTCTGTGTTCATTTCGAAAGG - Intergenic
1065924981 10:30427355-30427377 TGCCATGTGGTCATTTCGGAAGG + Intergenic
1076279542 10:129234069-129234091 TGTTCTCTGGTCATTTGGAATGG - Intergenic
1079874364 11:25838257-25838279 GGCCCTCTTGTAATGTCAAAAGG - Intergenic
1082004385 11:47411747-47411769 GGCCCTGTGGGCATTTGGCAGGG + Intronic
1084090937 11:66879076-66879098 GGCCCTCTGTTCATCTGGGAGGG - Intronic
1091588876 12:1831331-1831353 TGCCCCCTGGTCTTTTCGACGGG + Exonic
1097231969 12:57518190-57518212 GTCCCTGTAGCCATTTCGAAGGG + Intronic
1098123605 12:67268189-67268211 GGCTCTCTGTTCTTTTAGAAAGG + Intergenic
1099265657 12:80443821-80443843 TACCCTCTGGTCATGTGGAAAGG + Exonic
1103175892 12:118862767-118862789 GGCCCTCTGCTGTTTTTGAAAGG + Intergenic
1114522994 14:23350588-23350610 GAGCCTCTGGTCATTGCAAAAGG + Intronic
1126937888 15:53731409-53731431 AGCACTCTGGGCATTTGGAATGG + Intronic
1127653718 15:61035609-61035631 GGCCTTCTGCTCATTTTGGAGGG + Intronic
1131587949 15:93716469-93716491 GGCCTTATGATCATCTCGAAAGG + Intergenic
1135044059 16:19140256-19140278 GGCCCTCTGGTCATTTCGAAGGG - Intronic
1153879235 18:9405752-9405774 GGCCCTCTGACCACTTCTAAAGG + Intergenic
1157370706 18:47108989-47109011 GGCCCTCTGGTCATTCACAATGG + Intronic
1157569142 18:48700689-48700711 GAGCCTCTGTTCACTTCGAAGGG + Intronic
1163373127 19:16913703-16913725 GGCCCTCTGGACATTGTGCATGG + Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1163823738 19:19511231-19511253 GCCCCTCTGGTTTATTCGAAGGG - Intergenic
1165323514 19:35100581-35100603 GGCCCTCTGCCCACTTCTAAAGG - Intergenic
932644883 2:73489784-73489806 CGTCCTCTGGTCATTTCTGAGGG - Exonic
935719812 2:105970058-105970080 GGCCCTCAGGTCTTTGGGAATGG - Intergenic
936014147 2:108944912-108944934 GGCCTTCTGCTCATGTCAAAGGG - Intronic
939704441 2:145435001-145435023 GTCCCTCTGGCCATTTTGAAAGG - Intergenic
944711439 2:202338308-202338330 GGCACTCTTATCATGTCGAAAGG + Intergenic
1177414799 21:20779983-20780005 GGCCCTATGGTAATTTCTGATGG - Intergenic
1179970709 21:44835733-44835755 GGCCCCCTGGCCATTTTCAAGGG + Intergenic
1183405896 22:37630391-37630413 GGCCCTCTGGACCTTTCTCAAGG - Intronic
962857944 3:139366595-139366617 GGTCCTCTGTTCTTTTGGAATGG + Exonic
967358448 3:188601325-188601347 TGCTCTCTGGTCATTTCCATAGG + Intronic
982228457 4:153186794-153186816 CTCCCTCTGGTCATTTCTTAAGG - Intronic
984600264 4:181718754-181718776 GGCCCTCTGGACATTCCTGAAGG + Intergenic
987144580 5:14979982-14980004 AGCCCTCTGGTCATTGGGATTGG + Intergenic
994144119 5:96373571-96373593 AGCCCTGTGGACATTTCGATAGG + Intergenic
1016406052 6:143731947-143731969 GGCCCTCTGGTGCTTTGAAATGG + Intronic
1017301036 6:152858321-152858343 GGCCATCTGTTCATTTGGGAAGG - Intergenic
1017403599 6:154092695-154092717 AGTCCTCTGGTCAATTAGAAAGG - Intronic
1019137415 6:169919416-169919438 GGCCCTCTGGGCTGTTCCAAAGG - Intergenic
1021064244 7:16154037-16154059 GGCTCTCAGGTCATCTCGTATGG + Intronic
1029161188 7:98553299-98553321 GGCCCTCTGGGCATGTCTTATGG - Intergenic
1029937823 7:104446223-104446245 TGCCCTTTGATCATTTGGAATGG + Intronic
1034949884 7:155290059-155290081 GGCCTCCTGCTCACTTCGAAGGG - Intergenic
1195474183 X:105265252-105265274 GTCCCTCTGGGCATTTTGAGAGG - Intronic
1202336788 Y:23820457-23820479 GACCCTGTGGTCATTTAGATGGG - Intergenic
1202361947 Y:24119870-24119892 GTCCCTGTGGTCATTTAGATGGG + Intergenic
1202363126 Y:24133226-24133248 GTCCCTGTGGTCATTTAGATGGG - Intergenic
1202507653 Y:25536891-25536913 GTCCCTGTGGTCATTTAGATGGG + Intergenic
1202508831 Y:25550243-25550265 GTCCCTGTGGTCATTTAGATGGG - Intergenic
1202533977 Y:25849614-25849636 GACCCTGTGGTCATTTAGATGGG + Intergenic