ID: 1135046880

View in Genome Browser
Species Human (GRCh38)
Location 16:19163204-19163226
Sequence CTGTGGGCATGGCTGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135046880_1135046884 -10 Left 1135046880 16:19163204-19163226 CCTATTTCCAGCCATGCCCACAG No data
Right 1135046884 16:19163217-19163239 ATGCCCACAGGATTTGCTCTTGG 0: 1
1: 0
2: 2
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135046880 Original CRISPR CTGTGGGCATGGCTGGAAAT AGG (reversed) Intronic
No off target data available for this crispr