ID: 1135046880 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:19163204-19163226 |
| Sequence | CTGTGGGCATGGCTGGAAAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1135046880_1135046884 | -10 | Left | 1135046880 | 16:19163204-19163226 | CCTATTTCCAGCCATGCCCACAG | No data | ||
| Right | 1135046884 | 16:19163217-19163239 | ATGCCCACAGGATTTGCTCTTGG | 0: 1 1: 0 2: 2 3: 10 4: 157 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1135046880 | Original CRISPR | CTGTGGGCATGGCTGGAAAT AGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||