ID: 1135046884

View in Genome Browser
Species Human (GRCh38)
Location 16:19163217-19163239
Sequence ATGCCCACAGGATTTGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135046879_1135046884 -9 Left 1135046879 16:19163203-19163225 CCCTATTTCCAGCCATGCCCACA No data
Right 1135046884 16:19163217-19163239 ATGCCCACAGGATTTGCTCTTGG 0: 1
1: 0
2: 2
3: 10
4: 157
1135046880_1135046884 -10 Left 1135046880 16:19163204-19163226 CCTATTTCCAGCCATGCCCACAG No data
Right 1135046884 16:19163217-19163239 ATGCCCACAGGATTTGCTCTTGG 0: 1
1: 0
2: 2
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135046884 Original CRISPR ATGCCCACAGGATTTGCTCT TGG Intronic
900169346 1:1258737-1258759 GGGCCAACAGGATTTGCTCATGG - Intronic
900800106 1:4732050-4732072 GTGCCAGCAGGATGTGCTCTTGG + Intronic
901520014 1:9776326-9776348 AAGCCAGAAGGATTTGCTCTTGG - Intronic
903305284 1:22408761-22408783 ATGGCCCTGGGATTTGCTCTAGG + Intergenic
904900214 1:33851322-33851344 ATGCCCACAGGAGATGCTCTGGG - Intronic
904937500 1:34141913-34141935 GAGCCAACAGGATTTGCTCATGG + Intronic
910734160 1:90433767-90433789 GTACCCTCAGGATTTTCTCTGGG - Intergenic
913057396 1:115175197-115175219 AAGCCCCCAGGTTTTGTTCTTGG + Intergenic
915296791 1:154927045-154927067 AAACCAACAGGATTTGCCCTTGG - Intronic
1063169193 10:3491272-3491294 CTGCCCATAGCATTTGCTCATGG + Intergenic
1069671882 10:70213035-70213057 ATGGATACAGGATTTCCTCTGGG + Intronic
1070586967 10:77773823-77773845 TTGCCGTCAGGATTTGCTGTAGG + Intergenic
1071434136 10:85631190-85631212 AAGGCCACAGAATTTGCTATTGG + Intronic
1071616066 10:87077620-87077642 ATGCCCACAGCTTTGGCTTTGGG + Intronic
1072229503 10:93402160-93402182 ATGCCCACATGCTTAACTCTTGG + Intronic
1074442526 10:113491303-113491325 ATGCTGACAGTATCTGCTCTAGG - Intergenic
1075524438 10:123171246-123171268 ATGCCCACAGAACTTGTCCTGGG + Intergenic
1076580079 10:131501652-131501674 ATGCTCCCAGGATGTCCTCTGGG + Intergenic
1079930458 11:26553156-26553178 GTTCCAACAGGATTTGCTGTAGG + Intronic
1080303978 11:30817042-30817064 ATGACCCCAGGATTCACTCTTGG + Intergenic
1085698507 11:78726172-78726194 TTTCCCACAGGATTAGATCTGGG + Exonic
1088110855 11:106259772-106259794 TTGCCAACAAGATTTGCTATTGG - Intergenic
1089375954 11:117994778-117994800 ATGCCAACAGTAAGTGCTCTGGG + Intronic
1090218528 11:124994195-124994217 ACGGCCACAGGATTTGCTTCTGG + Intronic
1092703035 12:11254353-11254375 GAGCCCACTGGATTTGCTCATGG - Intergenic
1098250475 12:68564120-68564142 CTGCCCACAGAACCTGCTCTAGG + Intergenic
1100759825 12:97794922-97794944 TTGCCCAGAGGGTTGGCTCTTGG + Intergenic
1101022095 12:100563856-100563878 ATGGCAACAGGATTTTCTTTGGG + Intronic
1103948021 12:124537876-124537898 ATGCCCCCAGGCTTGGCACTTGG + Intronic
1105758319 13:23490326-23490348 AAGGCCACAGGAAATGCTCTTGG - Intergenic
1109892882 13:68640977-68640999 ATGACCACAGGATTTGATCTTGG + Intergenic
1110160819 13:72376287-72376309 ATGCATATAGGATTTGCTGTTGG + Intergenic
1112564606 13:100542543-100542565 GTGCCCTCAGAATTGGCTCTAGG - Intronic
1112953881 13:105035742-105035764 ATGCCCACAGGTTTAGCATTTGG + Intergenic
1112966080 13:105195980-105196002 ATCCCCAAAGGATGGGCTCTTGG + Intergenic
1113237223 13:108292091-108292113 ATGGATACAGGATTTTCTCTGGG - Intronic
1113913077 13:113853746-113853768 ACGCCCACAGGAACTGCCCTTGG + Intronic
1113973272 13:114207017-114207039 ATCCCCTCAGGAATTGCACTGGG - Intergenic
1119036666 14:71236028-71236050 ATGTCCACAGGATTTGGTTCAGG + Intergenic
1121337090 14:93084028-93084050 ATGGCCACAGGACTTGCCTTGGG + Intronic
1123463870 15:20499189-20499211 ATCCACACAGGCTTTACTCTTGG - Intergenic
1123654193 15:22501239-22501261 ATCCACACAGGCTTTACTCTTGG + Intergenic
1124308100 15:28596435-28596457 ATCCACACAGGCTTTACTCTTGG + Intergenic
1125679756 15:41523324-41523346 ATGCCCGGAGGATTGGCTCCAGG - Exonic
1125827699 15:42690291-42690313 ATTCCCCCAGGATTTGCGCTTGG - Exonic
1131143349 15:89995937-89995959 GTGCCCACAGAATATGCACTGGG - Intergenic
1131472030 15:92705722-92705744 ATCCCTACAGGATTTGCTTCTGG + Intronic
1135046884 16:19163217-19163239 ATGCCCACAGGATTTGCTCTTGG + Intronic
1140806277 16:78535191-78535213 ATGGACACAGGATCTGCTCAGGG + Intronic
1143317887 17:6046559-6046581 CTTCCCAGAGGATGTGCTCTGGG - Intronic
1143939143 17:10520708-10520730 ATGCCCACAGTAGGTGCACTGGG - Intergenic
1144178495 17:12731028-12731050 ATGCTCGCAGGACTGGCTCTGGG - Intronic
1144940702 17:18937960-18937982 ATAGGCACAGGATTTTCTCTTGG + Intergenic
1145084391 17:19924117-19924139 ATGCCAACATCATTTACTCTGGG - Intronic
1145272737 17:21413373-21413395 ATCCCCCCAGGATGTTCTCTTGG + Intronic
1145310945 17:21700836-21700858 ATCCCCCCAGGATGTTCTCTTGG + Intronic
1147479912 17:40750544-40750566 CTGCGCACAGTAGTTGCTCTCGG + Exonic
1148213336 17:45821085-45821107 ATGCCCACAGGACTGGCCCGTGG - Intronic
1149037069 17:52146752-52146774 ATGCCCACAGCTTTTCTTCTTGG + Intronic
1151289705 17:73140892-73140914 ATGGAAACAGGATTTGTTCTTGG + Intergenic
1152295705 17:79465944-79465966 ATGCCCAGAAGCTTTGCTCAGGG - Intronic
1154312627 18:13279136-13279158 ATGCCCAATCGATTGGCTCTCGG + Intronic
1156927256 18:42596927-42596949 CTACCCACTGGATTTTCTCTTGG - Intergenic
1157882086 18:51330111-51330133 ATGACCACAGAATGTTCTCTTGG - Intergenic
1157936016 18:51873979-51874001 CTGCCCACAGGATTCTTTCTCGG - Intergenic
1162529503 19:11227754-11227776 ATGCTCACAGGATCTGCCCACGG - Intronic
1164885707 19:31776881-31776903 GTGCCCAGAGGATTGGCTGTGGG - Intergenic
1167297309 19:48659080-48659102 ATGTGGACAGGATTTGCTCATGG + Intergenic
926253554 2:11170169-11170191 AAGCCAACAGGATTTGCTGAGGG - Intronic
927449202 2:23192155-23192177 AAGCCAACAGGATTTGCACATGG + Intergenic
929073770 2:38060467-38060489 ATGCCAACTGGATTTGCTTGCGG + Intronic
931120915 2:59218707-59218729 ATGCCCAGAAGACTTGTTCTTGG + Intergenic
931769683 2:65486815-65486837 GTGCCCACAGGTCTTGCTCTTGG - Intergenic
931881654 2:66576187-66576209 TTGCCCGCTGGATTTCCTCTCGG - Intergenic
932212222 2:69941689-69941711 TATCCCCCAGGATTTGCTCTTGG - Exonic
932407726 2:71524937-71524959 TTGCCCACAGATGTTGCTCTGGG - Intronic
933350946 2:81151530-81151552 ATGTCCACAGGATTAGCACAGGG - Intergenic
935151589 2:100441494-100441516 ATGCACACAGGATATTTTCTAGG - Intergenic
935278878 2:101500700-101500722 ATGCCTGCAGAATTTGCACTTGG - Intergenic
938412324 2:131075308-131075330 AGGCCTACAGGATATGATCTAGG - Intronic
938438611 2:131304142-131304164 CAGCCCACAGTATTTGCTATAGG - Intronic
939486660 2:142821312-142821334 AAGTCCATAGGATTTGCTGTAGG + Intergenic
939527432 2:143314480-143314502 TATCCCACAGGATTTGCTCAGGG + Intronic
940205838 2:151200767-151200789 AGGCTCAAAGGATTTGGTCTAGG - Intergenic
940348478 2:152653375-152653397 ATGCACACAGGTTTTTTTCTAGG + Exonic
940791472 2:158033974-158033996 CTTCCTTCAGGATTTGCTCTGGG + Intronic
943164357 2:184299811-184299833 ATGTTCACAGGATATGCTCTAGG - Intergenic
945069826 2:205978678-205978700 TTGCCCACAGGATTTGTTTATGG + Intergenic
946589170 2:221224334-221224356 ATGGCCACAGGATTTACCCAAGG - Intergenic
1169785302 20:9353689-9353711 ATTCCCACAGCATTTGGTCCAGG - Intronic
1170198091 20:13711665-13711687 AGGCCCAAAGAATTTGCTTTTGG - Intergenic
1172477821 20:35252141-35252163 ATGCCCACATGCCTGGCTCTTGG - Intronic
1173710774 20:45153699-45153721 ATCCCCTCAGGATCTGCTGTGGG - Intergenic
1174077598 20:47948926-47948948 CTGCCCAAGGGATTAGCTCTGGG + Intergenic
1178598781 21:33978089-33978111 ACTCCCACAGGATCTGCTCAAGG - Intergenic
1179408317 21:41143176-41143198 ATGCCCACATAAGTAGCTCTCGG + Intergenic
1179655392 21:42841581-42841603 TTGCCCCCAGGCTGTGCTCTTGG - Intergenic
1180721042 22:17908647-17908669 ATGCCCACAGCACTTGCTCCTGG + Intronic
1181915641 22:26277767-26277789 ATGGCCACAGAATGGGCTCTGGG + Intronic
1183121261 22:35731880-35731902 GAGCCCACAGGATTTGTTCATGG + Intergenic
1183369746 22:37425777-37425799 ATGCCCACATGCTTTGCTGATGG + Intronic
954043656 3:47910421-47910443 CTGCCCCCTGGATTTGCTCTTGG + Intronic
954941352 3:54375913-54375935 GAGCCCACAGGAATTGCTCATGG + Intronic
956103899 3:65796736-65796758 ATGCCAACAGTATTTACTATCGG - Intronic
956249332 3:67219227-67219249 ATGCCCACAGAATCTGCTGCTGG + Intergenic
960349366 3:116574468-116574490 ATGACCACAGGTTGGGCTCTAGG - Intronic
962741197 3:138363608-138363630 AAGCACACAGGAGGTGCTCTGGG + Intronic
963090055 3:141475632-141475654 TTGCCCACAGGATTTGCATGGGG - Intergenic
964768110 3:160197937-160197959 ATGCCCAGAGGGTCTGCTCTGGG + Intergenic
966649392 3:182282443-182282465 ATAGCCACCGGAGTTGCTCTTGG - Intergenic
968672781 4:1861110-1861132 GTGCCTAGAGAATTTGCTCTAGG + Intergenic
969304967 4:6320476-6320498 ATGCCCATGGGCTTTGCACTGGG - Intergenic
969526609 4:7707039-7707061 TTGGCCACAGGTTTTGCTCAAGG - Intronic
969699766 4:8761725-8761747 CTGACCACAGGCTTTGCTCCAGG + Intergenic
970810654 4:20089610-20089632 ATGGCCATAGGGTTTACTCTGGG - Intergenic
971293429 4:25366915-25366937 CATCTCACAGGATTTGCTCTTGG - Intronic
975506785 4:75147219-75147241 ATGTCCATAGGATTTGCTAAAGG - Intergenic
977217811 4:94303308-94303330 ATGCCCAAAGGAAATGCTCAGGG + Intronic
977626431 4:99193856-99193878 ATGACCACAGGATGTGTTCAGGG + Intergenic
980076682 4:128301469-128301491 ATGCACACAGAATTTGTTCCAGG + Intergenic
985719467 5:1481714-1481736 TTGCCCACAGGAGTTGCACTGGG + Intronic
986660690 5:10057405-10057427 GTGCTCAGAGGATTTGCTGTTGG - Intergenic
986740245 5:10699658-10699680 ATGTCCTCAGGAATAGCTCTGGG - Intronic
987111540 5:14692359-14692381 ATGAGCACAGGATTTTCTTTGGG - Intronic
990466766 5:56078334-56078356 ATGCCCTGGGGATTTGCTCCTGG - Intergenic
991591704 5:68258117-68258139 GTGCCCACAGTGCTTGCTCTTGG - Intronic
996855308 5:127999156-127999178 ATGCTCACATAATTTGCTTTTGG + Intergenic
999034970 5:148337895-148337917 ACTTCCACAGGCTTTGCTCTAGG + Intronic
1000410774 5:160933735-160933757 ATGCCAACAGTTTTTGCCCTGGG + Intergenic
1001743309 5:174071079-174071101 CTCCCCACTGGATGTGCTCTAGG - Intronic
1004288036 6:14340797-14340819 ATGCCTACACGATTTGCTACAGG + Intergenic
1005599731 6:27414121-27414143 AAGCCAACAGGATTTGCTGATGG - Intergenic
1008392002 6:50963029-50963051 AAGCCAACAGAATTTGCTATAGG + Intergenic
1009770486 6:68138044-68138066 ATGCCCACAGGATGTGTCCATGG + Intergenic
1013590545 6:111616187-111616209 ATGTCCACAGGATTCGCCTTAGG - Intergenic
1017008049 6:150042179-150042201 AGGCCCAGAGGGTTTGCTCAAGG - Intergenic
1018194130 6:161339785-161339807 ATGGCCACAGGGTTTCCTTTGGG - Intergenic
1019828547 7:3302435-3302457 GTGCCCACAGCTTTTGCACTTGG + Intronic
1022279755 7:28895565-28895587 ATGTCCACAGAATTTGCACCAGG + Intergenic
1023847269 7:44129444-44129466 ATGCCCAGAGGTTTCTCTCTGGG - Intergenic
1024531459 7:50396877-50396899 ATCCCCACAGGAGATTCTCTGGG + Intronic
1028365964 7:90032595-90032617 TTTTCCACAGGATTAGCTCTTGG - Intergenic
1031760515 7:125707728-125707750 ATGACCACAGGATGTGTTCAGGG - Intergenic
1031761976 7:125724585-125724607 ATGCCCTCAAGACTTGCTTTGGG - Intergenic
1032171788 7:129590985-129591007 TTGCCCACAGGATTGCTTCTGGG - Intergenic
1033649711 7:143331541-143331563 ACACCCTCAGGATTTGCTGTGGG + Exonic
1034160718 7:148992571-148992593 ATGGCTACAGGATTTCCTTTGGG + Intergenic
1035346343 7:158202255-158202277 TTGCCCACAGTATTTCCTCATGG - Intronic
1039722116 8:40175292-40175314 ATGGCCACTGGGTTTACTCTGGG + Intergenic
1039945309 8:42123673-42123695 ATGCACACAGGATGAGGTCTGGG + Intergenic
1040752489 8:50727764-50727786 ATAGCCACAGGATCAGCTCTTGG - Intronic
1041787310 8:61649210-61649232 ATGCTGACAGGATTTGCTGATGG + Intronic
1041979774 8:63844307-63844329 AAGTCCACAGGATATTCTCTTGG + Intergenic
1043151562 8:76723661-76723683 ATGGACATAGGCTTTGCTCTGGG + Intronic
1048354243 8:133640496-133640518 TTGCCCACATGTTTAGCTCTCGG + Intergenic
1048581889 8:135735658-135735680 ATGCCCCCGGGATTTTCTCTTGG + Intergenic
1053098735 9:35351630-35351652 AGGGCCAGAGGATTTGCTCTTGG - Intronic
1054708382 9:68485718-68485740 ATGCTGCCAGGATCTGCTCTTGG + Intronic
1055711046 9:79062467-79062489 CTTCCCACAGGCTTTGCTTTAGG - Intergenic
1060616563 9:125021158-125021180 GTGCCCACAGGACTAGATCTTGG + Intronic
1062707754 9:137954596-137954618 ATGGCCACAGGGATTGGTCTGGG + Intronic
1187367604 X:18677342-18677364 ATGACCACAGAATTTGAGCTGGG - Intronic
1188767246 X:34109296-34109318 AAGCACAGAAGATTTGCTCTGGG - Intergenic
1188914493 X:35892762-35892784 GTGTCCACTGGATTTTCTCTTGG + Intergenic
1189494538 X:41497102-41497124 ATCCCCCCAGAATTTGTTCTGGG + Intergenic
1190725276 X:53186160-53186182 ATCACCACAGGATTTCTTCTGGG - Intergenic
1193371348 X:80700948-80700970 ATCCACACAGAATTGGCTCTAGG - Intronic
1193902624 X:87201234-87201256 AAACCCACAGGATTGGCTCTGGG + Intergenic
1197663012 X:129194077-129194099 AGGCCCAGAGGACTGGCTCTTGG - Intergenic
1198047876 X:132920704-132920726 ATGCCAAAAGTATTGGCTCTTGG - Intronic