ID: 1135047778

View in Genome Browser
Species Human (GRCh38)
Location 16:19168714-19168736
Sequence CCGCGCGCTCCCAGCCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135047778_1135047788 -2 Left 1135047778 16:19168714-19168736 CCCCTCCGGCTGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 96
Right 1135047788 16:19168735-19168757 GGAAGGGAGGGCCCACGGCTAGG 0: 1
1: 0
2: 2
3: 39
4: 332
1135047778_1135047787 -7 Left 1135047778 16:19168714-19168736 CCCCTCCGGCTGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 96
Right 1135047787 16:19168730-19168752 CGCGCGGAAGGGAGGGCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 126
1135047778_1135047794 27 Left 1135047778 16:19168714-19168736 CCCCTCCGGCTGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 96
Right 1135047794 16:19168764-19168786 CAAACTTGCTTCGAGAAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 165
1135047778_1135047793 26 Left 1135047778 16:19168714-19168736 CCCCTCCGGCTGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 96
Right 1135047793 16:19168763-19168785 ACAAACTTGCTTCGAGAAAAAGG 0: 1
1: 0
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135047778 Original CRISPR CCGCGCGCTCCCAGCCGGAG GGG (reversed) Intronic
900214110 1:1472037-1472059 CGGCGCGCTCCAGGCCGGTGGGG - Exonic
900221660 1:1512421-1512443 CGGCGCGCTCCAGGCCGGTGGGG - Exonic
903652995 1:24932423-24932445 CCGCGCCCTGCCAGCCGCGGAGG + Intronic
905797351 1:40823192-40823214 CTGCGCCCTCCCAGCCCTAGGGG + Intronic
906140609 1:43531564-43531586 GCGCCCCCTCCCAGCCGGCGGGG + Intronic
908523335 1:64965910-64965932 CCGCCAGCTCCCGGCCGGGGTGG - Intronic
913173966 1:116257048-116257070 CCCCAGGATCCCAGCCGGAGAGG - Intergenic
914000742 1:143692304-143692326 ACCCGCGCTCCCAGCCCGCGCGG - Intergenic
915325252 1:155078735-155078757 TCGCGCGCTCCCGACCGGAGCGG + Intergenic
919878727 1:201888824-201888846 CCGCGCTAACCCAGCCGGCGCGG - Exonic
920401638 1:205680094-205680116 CCGCGCTGTCCCAGGCGGGGCGG - Intronic
920805694 1:209231774-209231796 CCGCGCGCTCGGCGCCGGTGGGG + Intergenic
921152635 1:212414387-212414409 TTCCGCGCTCCCCGCCGGAGCGG - Intronic
922739490 1:228007259-228007281 CCGCGGGGTCCCTGCCCGAGGGG - Intronic
1076683198 10:132185859-132185881 CCGCGCGGTCACGGCAGGAGCGG - Intergenic
1076824736 10:132961149-132961171 CCGCGCGCTCTCAGTGCGAGGGG - Intergenic
1078729964 11:13964681-13964703 CCGCGCGCTCCCTCCCGGGCTGG - Intronic
1086064905 11:82733806-82733828 CCGCGCGCGCCGCGCCGGGGCGG - Exonic
1088522223 11:110712284-110712306 CCGCGGGCTGCCGGCCGGAGGGG + Exonic
1090978355 11:131694912-131694934 CAGCGCCCTCGCAGCCGGAATGG + Intronic
1101772059 12:107760927-107760949 GCGCGCGGGCCCGGCCGGAGCGG - Intronic
1103954184 12:124567384-124567406 CTGCGCGCCCCCAGCCCGATCGG - Intronic
1104965448 12:132507000-132507022 GGGCGGGCGCCCAGCCGGAGAGG + Intronic
1107605008 13:42048557-42048579 CCGCTCGGTTCCCGCCGGAGCGG - Intronic
1110318583 13:74135514-74135536 CCGCGCCCTCCGAGCCGCCGCGG - Intergenic
1110450902 13:75636520-75636542 CGGCGCCTTCGCAGCCGGAGCGG + Intronic
1112012068 13:95301130-95301152 CCCCTCGCCCCCAGCCGCAGAGG + Intronic
1113417356 13:110138552-110138574 CCGCGCGCACACAGCCGGCCAGG + Intergenic
1114482169 14:23042672-23042694 CAGAGCGGTCCCAGCCGCAGAGG - Exonic
1116409098 14:44601451-44601473 CCGGGCGCTGCCGGGCGGAGGGG - Intergenic
1117176798 14:53153410-53153432 CCCTGCCCTCCCAGCCAGAGGGG - Intergenic
1122768258 14:104085761-104085783 CCGCGCGCGCCATGCCGGACCGG - Exonic
1122817510 14:104320888-104320910 CCGCCCACACCCAGCTGGAGAGG + Intergenic
1122975054 14:105167629-105167651 CCGCGCGCGCCCAGGCGGGGCGG - Intronic
1124118397 15:26867863-26867885 CCGCGCGCTCCCAGCCCAGGAGG + Intronic
1128454155 15:67823338-67823360 CGGCGCGGTCACAGCCCGAGTGG - Intronic
1131144334 15:90001665-90001687 CCCCGCGCTGCCGGCCGGCGGGG + Intronic
1132682729 16:1149982-1150004 CCGCGTTCACGCAGCCGGAGCGG - Intergenic
1135047778 16:19168714-19168736 CCGCGCGCTCCCAGCCGGAGGGG - Intronic
1136172563 16:28497611-28497633 CCGCGGGCTCCCAGACAGCGAGG + Exonic
1137476043 16:48810982-48811004 CCGCGCGCTCCCAACTGGGCGGG - Intergenic
1142335796 16:89489522-89489544 TCTCGGGCTCCGAGCCGGAGGGG - Intronic
1142848079 17:2691718-2691740 CCGCGCTCGCCGGGCCGGAGGGG + Intronic
1143503294 17:7351190-7351212 CCTCGCGCTCCGAGCCTGGGTGG - Intronic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1148664035 17:49361734-49361756 CCGGGGCCTCCCAGCCGGATGGG + Intronic
1148777953 17:50106081-50106103 CCGCCCGCTCCCCGCCGCTGTGG - Intronic
1148899672 17:50866406-50866428 GCGCGCGCACCCCGACGGAGGGG - Intronic
1150624846 17:66835187-66835209 CCCCGCGCGCCCAGCCGGCGAGG + Exonic
1151801888 17:76383906-76383928 CCGGGGGCTCCGAGCCGGAGAGG - Intronic
1152118241 17:78401967-78401989 CAGCACGCTCCGAGCAGGAGCGG + Intronic
1153480625 18:5543481-5543503 GCGCTCGCCCCCAGCCCGAGGGG + Intronic
1160899652 19:1421360-1421382 CAGCGAGCTCCCAGCCTGAAAGG - Intronic
1161973464 19:7596344-7596366 CCGCGCTCCCGCAGCCGGCGGGG - Intronic
1162954477 19:14090708-14090730 CCGCGCGCGCCCAGCAGAAGCGG - Exonic
1162979285 19:14228279-14228301 CAGCGCGCTCACAGCCGCCGGGG + Intergenic
1165073457 19:33268549-33268571 CCGCCCGCTCCCTGCCTGAGTGG - Intergenic
1165924878 19:39320783-39320805 CCGCGCTCACCCAGCCCGGGGGG + Intergenic
1166304204 19:41928420-41928442 CCCCGCGCCCCCAGCCGGCCAGG - Intronic
927652238 2:24919879-24919901 CCGCGGGCGCCCGGCCGCAGGGG + Intergenic
928511620 2:32009601-32009623 CCCCGCGCCCGCAGCCGGAGAGG - Intronic
931377353 2:61719189-61719211 CCGCGTGCTCCCAGCTGGCAAGG - Intergenic
940751212 2:157628829-157628851 CCGCGCACCGCCAGCCGCAGGGG - Exonic
942965784 2:181891677-181891699 CCGCGCGGCCCCGGCCGGAAGGG + Intergenic
944271182 2:197786236-197786258 GCGGGCGCTGCAAGCCGGAGAGG + Exonic
1168891382 20:1297150-1297172 CCGCACGCTCACAGGTGGAGAGG - Exonic
1173210726 20:41029364-41029386 GCGCGCGCTCGCCGCCGGAGGGG + Intronic
1173823072 20:46030945-46030967 CCGCGGGCTTCTGGCCGGAGGGG + Intronic
1175874010 20:62220906-62220928 CCGGGCGGACCCAGCCGGAGGGG + Intergenic
1184035169 22:41914738-41914760 CAGCGCGATCCCTGCGGGAGCGG - Intergenic
953027363 3:39152958-39152980 CCGGGCGCCCCCGGCCGGCGGGG - Intronic
959049733 3:101513178-101513200 CCTCCCTCTCCAAGCCGGAGGGG - Exonic
967694407 3:192514856-192514878 TCGCGCGCGCCCAGGTGGAGGGG + Intronic
968756506 4:2418766-2418788 AGGCGCGCTCCCTGCCGGCGGGG + Intergenic
972740359 4:41881725-41881747 CCGCGCGCTCCTCTCCGCAGGGG + Intergenic
985593525 5:777463-777485 CGGCGCGCACCCAGACTGAGCGG + Intergenic
989043193 5:37249550-37249572 CCGCGCGCTCCCCTCCTCAGCGG + Intergenic
989375365 5:40755480-40755502 CCGGCCGCTCCCCGCTGGAGAGG - Intronic
998583475 5:143403732-143403754 CCGGCCGCTCCCCGCCCGAGGGG + Intronic
1001395933 5:171419698-171419720 CGGCGGGCGCCCAGACGGAGCGG + Exonic
1003569550 6:7247034-7247056 CCGCGCTCTCCCCGTCGGAGGGG - Exonic
1003603610 6:7541320-7541342 CCACGCATTCCCAGCCCGAGAGG + Intergenic
1004174552 6:13328465-13328487 CCGCGCGCGCCCAGACGGCCCGG + Intronic
1005591595 6:27334477-27334499 CCTCGGGCTCCAAGCCCGAGTGG - Intergenic
1007558102 6:42783138-42783160 CCGCGGGCTCGGAGCGGGAGCGG - Intronic
1007702235 6:43771944-43771966 CCGCGCGCACCCGGCCGGGCGGG - Intronic
1019538468 7:1540812-1540834 CCACGGCCTCCCAGCCGGTGCGG + Exonic
1020660372 7:10974183-10974205 CGGCGCGCAGCCAGCCGGACAGG - Exonic
1022715028 7:32891493-32891515 CCGCGGGCTCCCAGCCTGCCCGG + Intronic
1023846181 7:44121920-44121942 CTGCGCTCTCCTAGCCGGAAGGG + Exonic
1026948688 7:74332971-74332993 CCGCGTCCTCGCAGGCGGAGGGG + Intronic
1035129839 7:156641172-156641194 CCGCGCGCTTCCTGCATGAGTGG + Intronic
1042315184 8:67418863-67418885 CAGCACGCTCCCAACCAGAGGGG + Intergenic
1045510810 8:102810736-102810758 CCGCGCCCTCCCACCCAGCGCGG - Intergenic
1047262398 8:123274490-123274512 CCGCGCGCCCCCACCCCGTGCGG + Intronic
1048345222 8:133570810-133570832 CCGTGCGCTCCCAGAAGGGGTGG + Intronic
1049212236 8:141392102-141392124 CCGCGCGCCCCCGCCCCGAGCGG - Intronic
1049643518 8:143726121-143726143 CCGCACGCTGCCAGCCAGCGCGG - Exonic
1051897975 9:22008757-22008779 TCGCGCGCCCCCTGCCGGCGAGG + Intronic
1053151983 9:35749235-35749257 CCGGGCGCTTCCGGCCGGAAGGG + Intergenic
1057222242 9:93263682-93263704 GTGCGCGCTCCCGGCAGGAGAGG + Exonic
1057489600 9:95510971-95510993 AGGCGCGCGCCCAGCCGGCGCGG + Intronic
1059234702 9:112751327-112751349 CCGCGGGGTCGCAGCCGCAGAGG + Intronic
1059414746 9:114155844-114155866 CCGCGCGCTCTAAGCCGGCCTGG + Exonic
1060700733 9:125747319-125747341 CCGCGCGCTCCCCGCCCGCGCGG - Intergenic
1062276679 9:135734698-135734720 ACGCGCGCGCCCACCCGGGGCGG - Intronic
1062582947 9:137236445-137236467 CAGAGCCCTCCCAGCCGGGGAGG - Exonic
1185890237 X:3816088-3816110 TCTCGGGCTCCGAGCCGGAGGGG + Intergenic
1186561759 X:10620315-10620337 CAGCTCGCTCCCTGCCGGATGGG - Exonic
1188003495 X:25002569-25002591 CCGCGCGCGCCCTGGAGGAGGGG - Intergenic
1190024602 X:46912333-46912355 CCGCGCTCGCCCTACCGGAGCGG - Intronic