ID: 1135049810

View in Genome Browser
Species Human (GRCh38)
Location 16:19183738-19183760
Sequence CAGCATGCCCAGCTGGTACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 373}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135049810 Original CRISPR CAGCATGCCCAGCTGGTACT TGG (reversed) Exonic
900320585 1:2081573-2081595 CATCATGCCAAGGTGGTGCTGGG + Intronic
900716567 1:4148838-4148860 CACCATGCACAGCTGGGTCTTGG - Intergenic
900773060 1:4561250-4561272 CAGCCTGCCCAGCTGCTATGAGG - Intergenic
901451705 1:9339999-9340021 CTGCATGCCCAGGTGGTTCAGGG - Intronic
901792038 1:11658762-11658784 CTGAACGCACAGCTGGTACTTGG - Exonic
902282506 1:15384675-15384697 CAGCGTCCCCAGCTGGAGCTGGG + Intronic
902756204 1:18550780-18550802 CAGCGTGCCCAGCTGGTGCCTGG - Intergenic
903057623 1:20647443-20647465 CACCACGCCCAGCTGGGAGTTGG + Intronic
903213205 1:21829938-21829960 CAGCCTCCCCAGCTGACACTAGG + Intronic
903672037 1:25042147-25042169 CAGCATCCACAGCTGGCACTGGG + Intergenic
903737984 1:25542537-25542559 CAGCATGCTCAGGTGGTGCCAGG + Intergenic
903841549 1:26245322-26245344 CACCATACCCAGCTGGTTTTTGG + Intronic
904207153 1:28862770-28862792 CCCCAGCCCCAGCTGGTACTGGG + Exonic
904292893 1:29499034-29499056 GAGCAGGCCCAGATGGAACTGGG - Intergenic
904482568 1:30803215-30803237 CTGCAGTCCCAGCTGCTACTTGG + Intergenic
906082305 1:43101382-43101404 CAGCTTCCTCAGCTGGCACTGGG + Intergenic
906476711 1:46174340-46174362 CACCATGCCCAGACGGTGCTGGG - Intronic
907553961 1:55328662-55328684 CACCCTGCCCAGCAGGTAATAGG - Intergenic
910704903 1:90118415-90118437 CCACATGCCCAGCAAGTACTCGG - Intergenic
911150671 1:94594530-94594552 CAGCCTGGCCAGCAGGTGCTTGG + Intergenic
912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG + Exonic
912557956 1:110529874-110529896 GAGCCTGCCCAGCTGGTGCCTGG + Intergenic
915335448 1:155138336-155138358 CAGCAGGCCCAGCTGAAACAAGG - Exonic
915434201 1:155891199-155891221 CACCGTGCCCAGCTGATAGTGGG - Intergenic
915473616 1:156139730-156139752 AAGCAAGCGCAGCTGGTACCTGG - Exonic
917361517 1:174181623-174181645 CACCATGCCCAGCCTGTACAAGG + Intronic
917683064 1:177387266-177387288 TACCATGCCCAGCAGGTACAGGG + Intergenic
917898429 1:179516742-179516764 CAGCAAGCCTACCTGGTTCTGGG + Intronic
918105654 1:181413322-181413344 CAGCATGCCCACCTCGTCCGAGG - Intronic
919597002 1:199576756-199576778 CAGCATGCCCAGAAGACACTGGG + Intergenic
920775916 1:208936986-208937008 CAGCATGCCCAGCTCTTAAAAGG - Intergenic
921300850 1:213750202-213750224 CAGCACAGCCAGCTGATACTTGG + Intergenic
922344320 1:224683703-224683725 CTGAATGCCCAGCTGGTAAAAGG - Intronic
923099573 1:230801615-230801637 CAGCCTGCCCAGCTGAATCTTGG + Exonic
1065051314 10:21794932-21794954 CAGAATGCTCAGCTGGTAAATGG - Intronic
1065215798 10:23446980-23447002 CACCACGCCCAGCTAGTGCTGGG + Intergenic
1066101443 10:32121961-32121983 CAGCTTCCTCAGCTGGCACTGGG + Intergenic
1067069014 10:43119182-43119204 CAGCATCCCCAGCCTGCACTGGG + Intronic
1067260427 10:44685078-44685100 CAGCATGCCCACATGGAACCAGG + Intergenic
1067569104 10:47358817-47358839 CAGCCTGCCCATCTAGGACTGGG + Intergenic
1067692048 10:48508297-48508319 CCTCATGACCAGCTGTTACTGGG + Intronic
1070155767 10:73834204-73834226 CACCACGCCCAGCTTCTACTGGG + Intronic
1071277569 10:84069585-84069607 CACCGTGCCCGGCTGGTATTTGG - Intergenic
1071490984 10:86136186-86136208 CAGCATTCCCAGGTGTTCCTAGG + Intronic
1071529463 10:86377731-86377753 TAACATGCCCAGCTGGTATGTGG + Intergenic
1074198966 10:111215329-111215351 CACCATGCCCAGCTAGTTTTTGG + Intergenic
1074389568 10:113045506-113045528 CACCATGCCCAGGTGGGGCTGGG - Intronic
1076280855 10:129244575-129244597 CAGCATCCGCTGCTGGTCCTGGG - Intergenic
1076461439 10:130650019-130650041 CAGCATGCCCAGCTGCTGTACGG + Intergenic
1076691609 10:132226556-132226578 CAGCAGCCCCAGCTGAGACTGGG - Intronic
1076875056 10:133211701-133211723 CAGGAGGCCCAGCAGGTGCTTGG - Exonic
1077184312 11:1229488-1229510 CACCATGCCCAGCTGGCTCATGG - Intronic
1080068164 11:28044198-28044220 CAACATGCACAGCTGACACTAGG + Intronic
1080321714 11:31017733-31017755 CACCATGCCCAGCTAGTTTTTGG + Intronic
1081513764 11:43804299-43804321 TAGCATCCTCAGCTGGTACAAGG + Intronic
1083198034 11:61102592-61102614 CAGCATCCCCAGCAGGTACAAGG - Exonic
1083945229 11:65919598-65919620 CCGCCTGCCCAGCGGGAACTGGG - Intronic
1084199411 11:67545458-67545480 CAGCGTCCCCTGCTGGTACCAGG + Intergenic
1084289000 11:68149848-68149870 CAGCATGCCCAGCCTGGACTTGG - Intergenic
1084480049 11:69414911-69414933 CCGCAAGGCCAGCTGGTCCTGGG - Intergenic
1085100709 11:73797536-73797558 CAGCTTTCACAGCTGGCACTGGG - Intronic
1085482169 11:76831667-76831689 CACCATGCCCAGCTGATACTGGG - Intergenic
1086092876 11:83021435-83021457 CAGCTTTCCCAGCTGGCACTGGG - Intronic
1089244842 11:117111187-117111209 CACCATGCCCAGCCCGTGCTTGG - Intergenic
1090124787 11:124074831-124074853 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1090249876 11:125243908-125243930 CACCATGCCCAGCCTGTACCTGG + Intronic
1090414723 11:126533093-126533115 TACCATGCCCAGCTAGTAATAGG + Intronic
1090712478 11:129400022-129400044 CACCATGCCCAGCTGAGACTTGG + Intronic
1091282072 11:134387506-134387528 CTGCCTGCCCAGCTGGGCCTTGG - Intronic
1091549254 12:1525478-1525500 CACCATGCCCAGCCAGTACTTGG + Intergenic
1091552682 12:1548736-1548758 CACCATGCCCGGCTGAGACTGGG - Intronic
1091630520 12:2156898-2156920 CAGCTTTCCCAGCTGCCACTGGG - Intronic
1093050568 12:14499669-14499691 CAACATGCCCAGCTAATTCTGGG - Intronic
1093764870 12:22951954-22951976 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1095583517 12:43826412-43826434 CAGCAGTCCCAGCTGGCAATTGG - Intergenic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1097853463 12:64436856-64436878 CACCATGCCCAGCTGATTCTGGG + Intronic
1097943329 12:65337278-65337300 CACCATGCCCAGCTGATTTTTGG - Intronic
1100198899 12:92277727-92277749 CACCATGCCCAGCTGGGTTTGGG + Intergenic
1101935676 12:109054230-109054252 CACCATGCCCAGCTGGTGAAAGG - Intronic
1102514890 12:113439805-113439827 CAGCATGCCCAGCTGGAGTGAGG - Intergenic
1102833214 12:116027132-116027154 CACCTTGCCCAGCTGTTATTAGG - Intronic
1102922211 12:116800206-116800228 CACCATGCCCGGCTGAGACTAGG - Intronic
1103523675 12:121552942-121552964 CACCGTGCCCGGCTGGTACTGGG - Intronic
1103578130 12:121894016-121894038 AAGGATGCCCAGCTTGTACATGG + Intronic
1104717815 12:131028032-131028054 CAGCATGAACAGCTGGTGCCCGG + Intronic
1105240985 13:18609605-18609627 CAGCCTGCGCAGCGGGCACTCGG - Intergenic
1105886800 13:24649441-24649463 CAGCATTCTCAGAGGGTACTGGG - Intergenic
1106770566 13:32957496-32957518 CAGCTGGCCCAGCTGGGGCTGGG + Intergenic
1107127285 13:36859284-36859306 CTGCATGTCCAGGTGGTATTTGG - Intronic
1107820487 13:44281335-44281357 CTGCATGCAGAGCTGGTCCTGGG + Intergenic
1107999388 13:45892432-45892454 CTGCATTCCTAGCTGGGACTGGG + Intergenic
1108359889 13:49659402-49659424 CATCATGCCTAGCTGGTTGTTGG + Intergenic
1108858972 13:54829762-54829784 CAGCCTGCCCTGCTGGCCCTGGG - Intergenic
1109622118 13:64924761-64924783 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1109982371 13:69924848-69924870 CAGCTTCCACAGCTGGCACTGGG - Intronic
1110567895 13:76974639-76974661 CAGCTACCCCAGCTAGTACTGGG + Intergenic
1110722267 13:78776845-78776867 AATCATGCATAGCTGGTACTAGG + Intergenic
1110810766 13:79808554-79808576 CAGCTTCCCCAGCTGGCACTGGG - Intergenic
1115652234 14:35411007-35411029 CTGCATGCCCATCTGGCTCTTGG + Intergenic
1115675272 14:35666511-35666533 CACCATGCCCAGCCTGGACTGGG + Intronic
1117651662 14:57914273-57914295 CACCATGCCCGGCTGAGACTGGG - Intronic
1119177211 14:72577844-72577866 CAACAAGCCCATCTGTTACTGGG - Intergenic
1119646952 14:76354997-76355019 CACCATGCCCGGCCGGTCCTGGG + Intronic
1121824548 14:96999893-96999915 TAGCTTCCCCAGCTGGCACTGGG + Intergenic
1122446560 14:101773845-101773867 CACCATGCTCAGCTGATATTTGG + Intronic
1122491355 14:102117920-102117942 CAGCTTCCCCAGCTGGCACTGGG - Intronic
1122832112 14:104403516-104403538 CTGCATGCCCACCTGGTACCAGG + Intergenic
1122896436 14:104759860-104759882 CAGCTCGCCCAGCTGGTAAATGG + Intronic
1123490372 15:20775540-20775562 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1123546873 15:21344627-21344649 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1124916062 15:33975641-33975663 CACCGTGCCCAGCTGGGACCTGG - Intronic
1125720951 15:41844931-41844953 CAGCACACCCAGCTTGTTCTTGG - Exonic
1126013854 15:44330575-44330597 CAGCATACCCAGCTAGTTTTGGG - Intronic
1126215312 15:46147025-46147047 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1127085584 15:55421596-55421618 CACCATGCCCAGCCAGTCCTGGG - Intronic
1127906417 15:63379626-63379648 CTGCAGACCCAGCTGGTACTGGG + Intronic
1129304907 15:74652889-74652911 CACCACGCCCAGCTGGTAAAGGG - Intronic
1129508364 15:76101941-76101963 CAGCATCCCCAACTGGAATTAGG + Intronic
1129778820 15:78255577-78255599 CATCAGGACCAGCTGGGACTGGG - Intergenic
1129859154 15:78846972-78846994 CAGCCAGCCCTGCTGGTCCTGGG + Intronic
1131267300 15:90924262-90924284 CTGCAGACCCAGCTGGTCCTGGG - Intergenic
1132123677 15:99200233-99200255 CACCATGCCCTGCTGGCTCTTGG - Intronic
1132270636 15:100520808-100520830 CAGCAAGCACAGCTGGTGCCGGG + Intronic
1202955204 15_KI270727v1_random:71843-71865 CAGCCTGCGCAGCAGGCACTCGG + Intergenic
1132463863 16:68647-68669 CAGCCCCCCCAGCTGGTCCTGGG - Intronic
1132939704 16:2500648-2500670 CAGCCTGGACAGCTGGTCCTGGG + Intronic
1134446627 16:14336165-14336187 CACCGTGCCCGGCTGGTACCTGG - Intergenic
1134489790 16:14688111-14688133 CAGGATGCCCAGGGGATACTCGG + Intronic
1134495170 16:14727228-14727250 CAGGATGCCCAGGGGATACTCGG + Intronic
1135034555 16:19066146-19066168 CACCACGCCCAGCTGAGACTGGG - Intergenic
1135049810 16:19183738-19183760 CAGCATGCCCAGCTGGTACTTGG - Exonic
1135089301 16:19500167-19500189 CACCATGCCCGGCTGCTGCTTGG + Intergenic
1135310479 16:21401226-21401248 CAGGATGCCCAGGAGATACTCGG - Intergenic
1135448368 16:22537424-22537446 CAGGATGCCCAGGGGATACTCGG + Intergenic
1136401971 16:30024150-30024172 CAGCCTGCCCCGCTAGAACTGGG - Intronic
1136506725 16:30709139-30709161 CACCACACCCAGCTGGAACTGGG - Intronic
1137334211 16:47532653-47532675 CAGCTTCCACAGCTGGCACTGGG + Intronic
1137552480 16:49448793-49448815 CACCATGCCCAGCTGATATTTGG + Intergenic
1138317241 16:56080861-56080883 CACCATGCCCAGCCAGGACTTGG + Intergenic
1139336244 16:66233592-66233614 CAGCATGCAAAGCTGGTGCAAGG - Intergenic
1139855352 16:69975376-69975398 CAGGATGCCCAGGGGATACTCGG - Intergenic
1139885068 16:70202491-70202513 CAGGATGCCCAGGGGATACTCGG - Intergenic
1139923375 16:70473081-70473103 CAGCATCCACAGCAGGTCCTGGG - Exonic
1140367448 16:74393022-74393044 CAGGATGCCCAGGGGATACTCGG + Intergenic
1142237116 16:88927574-88927596 CTGCATGCCAGGCTGGTACCTGG - Intronic
1144032634 17:11336053-11336075 CACCATGCCCAGCTAGTTTTTGG - Intronic
1144949936 17:18988683-18988705 CAGCATTCCCAGGTGTTACAAGG - Intronic
1145128417 17:20320635-20320657 CTGCCCGCCCAGCTGCTACTCGG - Intergenic
1145974957 17:28978560-28978582 CAGCATGTGCAGCTGGGACTTGG + Intronic
1146574672 17:33980627-33980649 CAGCATCCCCAGCAGGTAGCAGG - Intronic
1147114038 17:38285446-38285468 CACCGTGCCCAGCTGAGACTGGG + Intergenic
1148415567 17:47503744-47503766 CACCGTGCCCAGCTGAGACTGGG - Intergenic
1148635312 17:49144609-49144631 CACCATGCCCAACTGGAGCTAGG - Intronic
1148740810 17:49891229-49891251 CGGCTTGCCCAGCTGTAACTGGG + Intergenic
1148961850 17:51399939-51399961 CACCATGCCCAGCTGATAGCAGG + Intergenic
1149362424 17:55910081-55910103 CAGCTTCCCCGGCTGGTACTGGG + Intergenic
1149878825 17:60267117-60267139 CACCATGCCCAGCTGTAAATAGG - Intronic
1151232609 17:72695471-72695493 CATAATGCCCAGTTAGTACTTGG - Intronic
1151503318 17:74507014-74507036 CACCATGCCCAGCTGTTTTTTGG + Intergenic
1151739563 17:75971001-75971023 CATCATGCCCAGCTAGTTTTGGG - Intronic
1152154657 17:78625023-78625045 CACCACGCCCAGCTGGAACAGGG - Intergenic
1152193415 17:78902394-78902416 CACCATGCCCAGCCTGCACTGGG + Intronic
1152241065 17:79161418-79161440 CAGCATCCCCAGCTGGTATGCGG - Intronic
1152611825 17:81318771-81318793 CACCATGCCCGGCCGGCACTGGG - Intronic
1152729997 17:81965270-81965292 CACTGTGCCCAGCTGGTACGGGG + Intergenic
1152892992 17:82892998-82893020 CAGCTGGCCCAGCCGGTTCTTGG - Intronic
1153108585 18:1557940-1557962 CACCATGCCCAGCTAATCCTTGG + Intergenic
1153460530 18:5328095-5328117 CACCACACCCAGCTGGTATTTGG - Intergenic
1154181816 18:12144987-12145009 CAGCATGCCCAGCTAATTTTTGG - Intergenic
1154182087 18:12146597-12146619 CAGCATGCCCAGCTAATTTTTGG + Intergenic
1154447979 18:14450297-14450319 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1155866742 18:30974647-30974669 CACTATGCACAGCTGGTACCTGG + Intergenic
1156102414 18:33613200-33613222 CATCATGGCCAGATGGTTCTGGG + Intronic
1157450776 18:47786723-47786745 CACCATGCCCAGCTATTAGTTGG - Intergenic
1157710171 18:49844535-49844557 CAGCAGCTCCAGTTGGTACTTGG + Intronic
1158023287 18:52868946-52868968 CAGTTTCCCCAGCTGGCACTGGG + Intronic
1158993576 18:62894483-62894505 CACCAGGCCCAGCTGATAATTGG + Intronic
1160814299 19:1028188-1028210 CCGCAGGCCCAGCAGGTACTGGG - Intronic
1160825344 19:1077728-1077750 CTGCATGCCCAGCTGGGCCATGG + Intronic
1160967209 19:1752028-1752050 CAGCCTGCCCAGCTGGGAGCCGG - Intergenic
1161236707 19:3201841-3201863 CAGCATTCCCAGCAGGTTCCTGG - Intronic
1161759277 19:6159366-6159388 CAGCATTCCCAGCTGGAAGAAGG - Intronic
1161980155 19:7626124-7626146 CGGCAGGCCCACCTGGTAGTTGG + Exonic
1162003087 19:7760511-7760533 CACCATGCCCAGCCTGTTCTAGG + Intergenic
1162361807 19:10224887-10224909 CACCATGGGCAGCTTGTACTCGG - Exonic
1163043968 19:14625266-14625288 CACCATGCCCAGCTAATGCTGGG + Intronic
1163649710 19:18510077-18510099 CATCGTGCCCAGCTGGGACATGG - Intronic
1163893200 19:20034940-20034962 CAACATGCCCGGCTGGTTTTTGG - Intronic
1164560842 19:29291064-29291086 CAGCATCCCCTGCTGGTAGAGGG + Intergenic
1168111885 19:54197226-54197248 AAGCATGCCCAGCTGGTCCTTGG + Intergenic
1168707849 19:58479960-58479982 CAGCATCCCCAGCTCTGACTGGG - Exonic
925291680 2:2752195-2752217 CAGCCTCCCCAGCAGGTGCTAGG + Intergenic
925573016 2:5331738-5331760 CACCATGCCCAGCTAATATTTGG + Intergenic
925770727 2:7280520-7280542 CCGTGTGCCCAGCAGGTACTGGG + Intergenic
926494531 2:13568552-13568574 CAGCAAAGCCACCTGGTACTGGG - Intergenic
926625552 2:15086644-15086666 CAGCTTCCTCAGCTGGCACTGGG - Intergenic
927226286 2:20768370-20768392 CAGCTTCCCCAGCTGGCACCAGG - Intronic
927266790 2:21161400-21161422 CAGCTTCCCCGGCTGGCACTGGG + Intergenic
927549518 2:23985667-23985689 CACCGTGCCCAGCTGATAATGGG + Intronic
930708915 2:54531334-54531356 TAGCATACCCAGTTGGTACTGGG + Intronic
931345071 2:61439121-61439143 CACCATGCCCAGCTGTTTTTAGG - Intronic
931584660 2:63812151-63812173 CACCATGCCTGGCTGGTATTTGG + Intronic
932045149 2:68340980-68341002 CAGCATGCCAAGCTGACAATAGG - Intergenic
932522553 2:72428394-72428416 CAGCTTCCCCAGCTGGTACCAGG - Intronic
933722527 2:85407422-85407444 CACCATGCCTGGCTGGCACTGGG - Intronic
935137574 2:100321494-100321516 CAGCCTGCGCAGCCGGCACTCGG + Exonic
935737520 2:106118123-106118145 CAGGAAGCCAAGCTGCTACTGGG + Intronic
937082245 2:119148404-119148426 AAGCATTCCCAGCACGTACTGGG + Intergenic
939960184 2:148559430-148559452 CAGCATGCCCAGCTAATTTTTGG - Intergenic
942272783 2:174293563-174293585 CACCATGCCCAGCTGCCATTGGG + Intergenic
942509961 2:176687529-176687551 CAGCATGCCCAGCTAAAAATAGG + Intergenic
943737665 2:191374611-191374633 CAGCACTTCCAGCTGGTACTGGG - Intronic
943942709 2:194020260-194020282 CAGCCTGCCCCGCTGGCCCTGGG + Intergenic
945762877 2:213936118-213936140 CAGCAAGCCAAGCAGATACTTGG + Intronic
947335984 2:229083758-229083780 CAGCTTGCCAAGGTTGTACTTGG - Intronic
947511816 2:230762194-230762216 CACCGTGCCCAGCTGGTAAGTGG + Intronic
947720953 2:232368972-232368994 CACCATGCCCAGCTGTTTTTGGG + Intergenic
947997597 2:234541948-234541970 CACCATGCCCAGCTGAGACAGGG + Intergenic
948365520 2:237452167-237452189 GAGCATGGCCAGCAGGAACTGGG - Intergenic
949053913 2:241914327-241914349 CAGCATCCCCACCTGGGCCTGGG - Intergenic
1168983321 20:2026306-2026328 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1170696309 20:18662407-18662429 CACCATGCCCAGCTGGGGGTGGG + Intronic
1170894830 20:20403630-20403652 CTGCATGCCCAGATGTTACCTGG + Intronic
1171070414 20:22062766-22062788 CAGCTTGCCCAGCTGGGGCAAGG - Intergenic
1171148300 20:22804810-22804832 CTGCATGCCCATGTGGTACTTGG + Intergenic
1171472241 20:25381382-25381404 CAGCATTCACAGGTGTTACTGGG + Intronic
1172047951 20:32094118-32094140 AAGAATGCACAGCTAGTACTGGG - Intronic
1172533125 20:35647764-35647786 CACCGTGCCCAGCTGGTAAATGG - Intronic
1172998505 20:39088900-39088922 CATGATGCCCAGCCCGTACTAGG - Intergenic
1173403352 20:42744064-42744086 CAGCCAGCCCAGCTGGTCATGGG - Intronic
1173884449 20:46445308-46445330 CAGCTTCCACAGCTGGTACTGGG + Intergenic
1175056121 20:56199961-56199983 GAGCATGCCCAGCATGTTCTAGG - Intergenic
1175413656 20:58787412-58787434 CAGGATGCTGAGCTGGGACTCGG + Intergenic
1175608449 20:60330462-60330484 CTGCCTGCCCACCTGGTGCTGGG + Intergenic
1176088443 20:63308483-63308505 CAGCATCCCCTCCTGGTGCTCGG - Intronic
1176150981 20:63590528-63590550 CAGTCTGCCCAGCTGGCGCTTGG - Exonic
1176164225 20:63664431-63664453 CAGCATCCCCACCAGGTACCAGG - Intronic
1176408524 21:6434985-6435007 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1177262698 21:18750665-18750687 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1177676626 21:24309026-24309048 CAGCATCCCAAGGTGGTACAGGG + Intergenic
1177796969 21:25789032-25789054 CACCACGCCCCGCTGGGACTAGG - Intergenic
1178406907 21:32331951-32331973 CAGCATGCCCAGCAGTGACTGGG + Intronic
1178570845 21:33735712-33735734 CACCATGCCCGGCTGGAATTAGG - Intronic
1179169555 21:38962414-38962436 CAGGATGCCCAGCAGGAAGTGGG - Intergenic
1179684017 21:43043311-43043333 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1179898767 21:44378070-44378092 CAGCCTCCCCAGCAGGTCCTGGG - Intronic
1180709534 22:17830563-17830585 GAGCATGCACAGCTGGTCCAGGG - Intronic
1181114726 22:20624408-20624430 CAGCACGCTGAGTTGGTACTGGG - Intergenic
1181989714 22:26828293-26828315 GAGCAGGCCCAGCTGGGATTAGG - Intergenic
1182585265 22:31341282-31341304 CAGCATGCCCAGCTCCTCCCTGG - Intronic
1182928923 22:34154391-34154413 CACCGTGCCCAGCTGGAATTTGG + Intergenic
1183024872 22:35057570-35057592 CAGCTTTCACAGCTGGCACTGGG + Intergenic
1183734984 22:39639960-39639982 GAGCCTGCCCAGATGGTTCTAGG - Intronic
1184560812 22:45261991-45262013 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1184865726 22:47200970-47200992 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1184869324 22:47225342-47225364 CAGCTTCCCCAGCTGGCACCAGG + Intergenic
1184879758 22:47297410-47297432 TAGGATGCCCAGCTGGTCGTTGG + Intergenic
1185215866 22:49599762-49599784 CAGGATGCCCAGCTGGTGTCTGG + Intronic
949637616 3:6000409-6000431 CACCATGCCCAGCTGATGGTGGG + Intergenic
949910042 3:8896084-8896106 CAGCATGCCCAGATGGGCTTGGG - Intronic
951562321 3:23981445-23981467 CAGCTTTCCCAGCTGGCACCTGG + Intergenic
953463073 3:43096999-43097021 CCACCTGCCCAGCTGTTACTGGG - Intronic
953817393 3:46170583-46170605 CAGCATGCCCAGCTGGTGCCAGG - Intronic
954334284 3:49907245-49907267 CACCATGCCCGGCCTGTACTAGG + Intronic
956797943 3:72732952-72732974 CAGAAAGCCCTGCTGATACTTGG + Intergenic
961942873 3:130656002-130656024 CAGCTTCCACAGCTGGCACTGGG + Intronic
962785822 3:138767769-138767791 CAGCTTCCACAGCTGGCACTGGG + Intronic
962864818 3:139439471-139439493 CTGCCTGCCCAGCTGGTCATAGG - Intergenic
963503086 3:146153014-146153036 CAGAATGCCCTGCTGGTCCAGGG - Intronic
965813279 3:172613569-172613591 TAGCTTCCCCAGCTGGCACTGGG + Intergenic
966462715 3:180195379-180195401 AAGCATGCTCAGCTGGTATCTGG + Intergenic
968538529 4:1150375-1150397 CAGCTTCCACAGCTGGCACTGGG + Intergenic
968755258 4:2412452-2412474 CAGCATCCCCACCTGACACTAGG + Intronic
969261308 4:6035896-6035918 CAGCAGGCCCAGCAGGTAGGCGG - Exonic
969446968 4:7250716-7250738 CTGCCTGCCCAGCTGTTCCTCGG - Intronic
970716291 4:18928871-18928893 CACCACGCCCAGCTGTAACTTGG + Intergenic
970959761 4:21857951-21857973 CAGCTTCCACAGCTGGCACTGGG - Intronic
971529665 4:27670644-27670666 CTGAAGGCCCAGCTGATACTTGG + Intergenic
972512605 4:39783817-39783839 CACCATGCCCAGCTAATATTTGG - Intergenic
972811760 4:42596379-42596401 CACCATGCCCAGCTAATAGTTGG - Intronic
974077532 4:57181153-57181175 CAGCTTGCCCAGCAGTTACTTGG - Intergenic
974646849 4:64705447-64705469 CACCATGCCCAGAGGGTTCTAGG - Intergenic
975324254 4:73041987-73042009 CACCACGCCCAGCTGGTAGTTGG - Intergenic
976140555 4:81987034-81987056 CACCACGCCCAGCTGCTTCTTGG + Intronic
976647443 4:87400516-87400538 CAGCTTCCACAGCTGGCACTGGG - Intergenic
976734429 4:88295986-88296008 CAGCTTCCACAGCTGGCACTGGG + Intergenic
977606084 4:98986216-98986238 CACCATGCCCAGCCGGAAATGGG + Intergenic
978229801 4:106385183-106385205 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
978619004 4:110621399-110621421 CAGCATGCCCACCTGCAACGCGG + Intronic
979462965 4:121004100-121004122 CAGCTTCCCCAGCTGGCACCAGG - Intergenic
979808126 4:125000673-125000695 CACCATGCCCAGCTGATTTTAGG + Intergenic
980253528 4:130348788-130348810 CAGCTTCCACAGCTGGCACTGGG + Intergenic
980493424 4:133560324-133560346 CAGCTTCCACAGCTGGGACTAGG + Intergenic
981363581 4:143875452-143875474 CAGCAGGTGCAGCTGGTTCTAGG + Intronic
981374940 4:144004025-144004047 TAACATGCCCAGATGGGACTTGG - Intronic
981383416 4:144099511-144099533 CAGCAGGTGCAGCTGGTTCTAGG + Intergenic
984102029 4:175498790-175498812 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
984725717 4:183018632-183018654 CAGCATTGCCACCTGGTACCAGG + Intergenic
985856325 5:2430108-2430130 CAGCCTGACCAGCTGGGGCTGGG - Intergenic
986666455 5:10108757-10108779 CAGCCAGCCCATCTGGGACTGGG - Intergenic
988531846 5:32034642-32034664 CATCACGCCCAGCTGGAACCAGG + Intronic
989520778 5:42397296-42397318 CAGCTTCCACAGCTGGCACTGGG - Intergenic
991230268 5:64324468-64324490 CAGCAGCCCCAGCTGGAAATCGG + Intronic
991359171 5:65802383-65802405 CAGCTTTCACAGCTGGCACTGGG + Intronic
991974597 5:72173838-72173860 CACCACGCCCAGCAGGAACTAGG - Intronic
991983593 5:72259179-72259201 CACCATGCCTAGCTGGGAATCGG - Intronic
992721136 5:79562224-79562246 CATCACACCCAGCTGGCACTGGG + Intergenic
994755459 5:103789146-103789168 CACCATGCCCAGCTGAATCTGGG + Intergenic
996152564 5:120057920-120057942 CACCATGCCCAGCTGATTTTGGG - Intergenic
996192693 5:120564696-120564718 CACCATGCCCAGCCAGTACCTGG - Intronic
997043696 5:130288136-130288158 TATTATGCCCTGCTGGTACTAGG + Intergenic
997185446 5:131877355-131877377 CATCATGCCCAGCTGGAATCTGG - Intronic
998095748 5:139394764-139394786 CAGCGTGCGCAGCTGGGGCTGGG + Exonic
998651204 5:144123600-144123622 CACCATGCCCAGCTAATTCTTGG - Intergenic
999778713 5:154831601-154831623 CACCATGCCCAGCTAGGACTCGG + Intronic
1000824168 5:166023489-166023511 AAAGATGCCCAGCTGGTAATTGG + Intergenic
1001001667 5:168013313-168013335 CACCGTGCCCAGCTGAAACTTGG - Intronic
1001581658 5:172802631-172802653 CACCATGCCCAGCTAGAACCAGG + Intergenic
1002162739 5:177325633-177325655 CACCATGCCCAGCTAGTTTTTGG - Intergenic
1003181428 6:3795186-3795208 CACCATGCCCAGCTGGGATCTGG + Intergenic
1004043420 6:12005094-12005116 CAGCATAACCAGCTGGTTCCTGG - Intergenic
1004321746 6:14636876-14636898 CATCCTCCTCAGCTGGTACTCGG + Intergenic
1004424956 6:15501030-15501052 CAGCTTGGCCAGCCGGTCCTGGG - Exonic
1004894278 6:20131839-20131861 CAGCATGCCCAGGAGCTAGTTGG + Intronic
1006980086 6:38140641-38140663 CACCATGCCCAGCTGTTCATGGG + Intronic
1007650333 6:43415966-43415988 CACCATGCCCAGCTGCTGCTGGG + Intergenic
1009846805 6:69145347-69145369 CAGCTTCCACAGCTGGCACTGGG + Intronic
1010561540 6:77357549-77357571 CACCGCGCCCAGCTGGTACTAGG + Intergenic
1011886155 6:92098223-92098245 CAGCATGCCCAGCTAATTTTTGG + Intergenic
1012231079 6:96762070-96762092 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
1013136974 6:107291722-107291744 CACCGTGCCCAGCTGGCACTTGG - Intronic
1013201800 6:107904967-107904989 CACCATGCCCAGCTGGGAGTTGG - Intronic
1013609785 6:111783776-111783798 CAGCACGCCCAGCTGGGAGTGGG + Intronic
1015301977 6:131663396-131663418 AACCATGCCCAGCTGGTGATGGG - Intronic
1016544314 6:145203397-145203419 CACCATGCCCAGCCTGTACCCGG - Intergenic
1016758760 6:147715413-147715435 CAGCTTCCACAGCTGGCACTGGG + Intronic
1017530893 6:155291242-155291264 CAGGATACCCAGCTGGTGTTCGG + Intronic
1018874767 6:167812061-167812083 CAGCATGCCCAGGTGAGCCTGGG + Intergenic
1019178948 6:170175522-170175544 CAGCGAGCCCTGCTGGCACTGGG - Intergenic
1019697880 7:2457654-2457676 CACCATGCCCAGCTGGCCATGGG + Intergenic
1021518788 7:21517506-21517528 CACCATGCCCAGCTGGTCCTGGG + Intergenic
1021534392 7:21687149-21687171 CTGCTGGCCCAGCTGGTACCGGG + Exonic
1022171267 7:27834405-27834427 GAGCATAGCCAGCTGCTACTTGG - Intronic
1022182834 7:27939103-27939125 CCTCATGGCCAGCTGCTACTTGG - Intronic
1022325967 7:29332201-29332223 CAGAAAGCCCAGCTGGTAAGGGG - Intronic
1022496596 7:30856800-30856822 CAGCATGCAGAGCTGGTACAAGG + Intronic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1023906236 7:44523575-44523597 CATCATGCCCAGCTGATATTTGG - Intronic
1024035114 7:45501377-45501399 CACCGTGCCCAGCCTGTACTGGG - Intergenic
1025142171 7:56475419-56475441 CAGCAGGCCTGGCTGATACTTGG + Intergenic
1025244444 7:57305679-57305701 CAACTTGCCCAGCTGGTAAGTGG + Intergenic
1025708320 7:63886834-63886856 CAGCAGGCCCAGCTGATACTTGG + Intergenic
1025926237 7:65962582-65962604 CACCATGGCCAGCTGAAACTCGG - Intronic
1026859143 7:73773770-73773792 CAGAGGGCCCAGCTGGTGCTGGG + Intergenic
1026951735 7:74352001-74352023 CAGCCAGCCCAGCTGGGAGTGGG + Intronic
1028024692 7:85822022-85822044 CAGCCTCCCCAGCTGTCACTGGG - Intergenic
1028641760 7:93050159-93050181 CAGCCTCCCTAGCTGGGACTGGG - Intergenic
1030289237 7:107855810-107855832 CATCATGCCCAGCTGTTTTTTGG - Intergenic
1030399295 7:109028390-109028412 CACCAGGCCCAGCAGTTACTAGG - Intergenic
1031998306 7:128247321-128247343 CAGCATGTCCAGCCAGTACTAGG + Intronic
1032240341 7:130154588-130154610 CAGGCTGCGCAGCTGGCACTTGG - Intergenic
1034432126 7:151046325-151046347 CAGCATCCCCAGCAGGTTCTGGG + Intronic
1034674380 7:152882057-152882079 CACCATGCCCAGCAGCGACTTGG - Intergenic
1035123376 7:156588756-156588778 CACCATGCCCAGCCTGGACTGGG - Intergenic
1035303964 7:157917854-157917876 CAGCAGGCCGAGCTGGGGCTGGG + Intronic
1035897949 8:3425299-3425321 CACCTTGCCCAGCTGGGACAGGG - Intronic
1036915361 8:12799214-12799236 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1037492039 8:19405849-19405871 CAGCATGCCCAGCTGGCCGTGGG + Exonic
1037714943 8:21389513-21389535 CAGGTTGCCCAGCAGGTATTAGG + Intergenic
1037791022 8:21941799-21941821 CAGTAGTCCCAGCTAGTACTTGG - Intronic
1037815387 8:22109222-22109244 CAGCGTGCACAGCTGCGACTCGG - Exonic
1038342288 8:26696716-26696738 CAGCAGGCCCAGTAGGTACAAGG - Intergenic
1039073548 8:33667805-33667827 CACTACACCCAGCTGGTACTTGG + Intergenic
1039711518 8:40060746-40060768 CAGTGTGCCCAGCTGGGAATTGG + Intergenic
1040445725 8:47491693-47491715 CACCATGCCAAGCTAATACTGGG - Intronic
1040464385 8:47680356-47680378 CAGCCAGCCCAGCTGTGACTGGG + Intronic
1041205401 8:55494232-55494254 CAGCACCCACAGCTGGCACTAGG + Intronic
1043568006 8:81570124-81570146 CAGCTTCCCCAGCTGGCACCAGG + Intergenic
1044344765 8:91092319-91092341 CACCATGCCCGGCTGGAACTAGG - Intergenic
1044978740 8:97693612-97693634 CACCATGCCCAGCCGTTTCTTGG + Intronic
1047406786 8:124592072-124592094 CACCATGCCCAGCCAGTAATAGG + Intronic
1049038850 8:140097638-140097660 AAGAATGCCCAGCTGGATCTTGG + Intronic
1049609320 8:143546288-143546310 CACCATGCCCAGCTGATTTTTGG - Intergenic
1049859810 8:144890624-144890646 GGGCCTGCCCAGCTAGTACTGGG + Intronic
1050302005 9:4268785-4268807 GATGCTGCCCAGCTGGTACTGGG - Intronic
1051694521 9:19753766-19753788 CAGGATGCCCATCTGGTCCTTGG - Intronic
1052552448 9:29969133-29969155 CAGCTTCCCCAGCTGGCACCAGG + Intergenic
1052787961 9:32847392-32847414 CACCATGGCCAGCTGGTAGGTGG - Intergenic
1053128308 9:35600326-35600348 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1053137172 9:35658482-35658504 CAGCAGCCCTAGCTGGTACCTGG - Exonic
1057985408 9:99708496-99708518 CACCATGCCCAGCTGATGTTAGG - Intergenic
1058836606 9:108863116-108863138 CACGATGCCCATCTGGTCCTGGG - Exonic
1060007351 9:120012347-120012369 CAGCAGGCACAGCTGGTAGCAGG + Intergenic
1060413734 9:123416335-123416357 CAACACCCCCAGCTGGTAATGGG + Intronic
1060688833 9:125638058-125638080 CCCCACGCCCAGCTGGTAATGGG + Intronic
1061066719 9:128282887-128282909 CACCATGCCCATCTGTCACTGGG - Intronic
1061675247 9:132211879-132211901 CAGCACGCCTACCTGGTTCTGGG - Intronic
1061912806 9:133733910-133733932 CAGCTTGGCCAGGTGGTACAGGG + Exonic
1062130396 9:134889647-134889669 CTGTAGGACCAGCTGGTACTGGG + Intergenic
1062363887 9:136199838-136199860 CGGGATGCCCAGCTGGCACGCGG + Exonic
1185766313 X:2728482-2728504 CACCGTGCCCAGCTGGTGTTTGG + Intronic
1185975745 X:4718408-4718430 CAGCACGCCAAGCTGGTAGACGG + Intergenic
1186805948 X:13140106-13140128 CAGCTTCCCCAGCTGGCACCAGG - Intergenic
1188859760 X:35243379-35243401 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1189090757 X:38080178-38080200 GAGCATGCACAGCTGGTAAAAGG + Intronic
1190758106 X:53418586-53418608 CACCATGCCCAGCTAGTTTTTGG + Intronic
1193108314 X:77703474-77703496 CAGCATCCACAGCTGGCACCAGG + Intronic
1193574928 X:83185345-83185367 CAGCTTCCCCAGCTGGCACCAGG + Intergenic
1199751461 X:150823572-150823594 CACCACGCCCAGCTGAAACTGGG + Intronic
1200975414 Y:9207433-9207455 CAGCTTCCACAGCTGATACTGGG + Intergenic
1201780545 Y:17716675-17716697 CAGCTTCCACAGCTGATACTGGG + Intergenic
1201796993 Y:17906559-17906581 CAGCTTCCACAGCTGATACTGGG - Intergenic
1201804560 Y:17999426-17999448 CAGCTTCCACAGCTGATACTGGG + Intergenic
1201821009 Y:18189315-18189337 CAGCTTCCACAGCTGATACTGGG - Intergenic
1202172064 Y:22060455-22060477 CAGCCTCCACAGCTGATACTGGG + Intergenic
1202219298 Y:22525916-22525938 CAGCCTCCACAGCTGATACTGGG - Intergenic
1202323882 Y:23670149-23670171 CAGCCTCCACAGCTGATACTGGG + Intergenic
1202341589 Y:23874581-23874603 CAGCTTCCACAGCTGATACTGGG - Intergenic
1202358366 Y:24075618-24075640 CAGCTTCCACAGCTGATACTGGG - Intergenic
1202512412 Y:25594495-25594517 CAGCTTCCACAGCTGATACTGGG + Intergenic
1202529177 Y:25795505-25795527 CAGCTTCCACAGCTGATACTGGG + Intergenic
1202546889 Y:25999905-25999927 CAGCCTCCACAGCTGATACTGGG - Intergenic