ID: 1135054320

View in Genome Browser
Species Human (GRCh38)
Location 16:19218430-19218452
Sequence CCTGTTGTGCATGCTGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135054315_1135054320 2 Left 1135054315 16:19218405-19218427 CCCTGGAAAAGTACAACCTGAAA No data
Right 1135054320 16:19218430-19218452 CCTGTTGTGCATGCTGTGTATGG 0: 1
1: 0
2: 3
3: 10
4: 174
1135054316_1135054320 1 Left 1135054316 16:19218406-19218428 CCTGGAAAAGTACAACCTGAAAT 0: 1
1: 0
2: 2
3: 18
4: 290
Right 1135054320 16:19218430-19218452 CCTGTTGTGCATGCTGTGTATGG 0: 1
1: 0
2: 3
3: 10
4: 174
1135054313_1135054320 22 Left 1135054313 16:19218385-19218407 CCGGATCAATGGGAATGGTTCCC No data
Right 1135054320 16:19218430-19218452 CCTGTTGTGCATGCTGTGTATGG 0: 1
1: 0
2: 3
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135054320 Original CRISPR CCTGTTGTGCATGCTGTGTA TGG Intronic
902975622 1:20086079-20086101 CCAGGTGTGCCTGCTGTGCAAGG + Exonic
903488299 1:23707884-23707906 GCCGCTGTGCAGGCTGTGTAGGG + Intergenic
904215203 1:28913987-28914009 CCTCTCGTGCCAGCTGTGTAAGG - Intronic
904453907 1:30635550-30635572 CCTGTGATCCATGCTGGGTAAGG + Intergenic
907325538 1:53636559-53636581 CCTATTGGACATTCTGTGTAAGG + Intronic
908588153 1:65597213-65597235 CCTGTTGTCCATGCTGTGTTTGG + Intronic
910162058 1:84283743-84283765 CTTGTGCTGCATTCTGTGTAAGG + Intergenic
912142617 1:106749729-106749751 CCTGATGAGGCTGCTGTGTATGG - Intergenic
912728260 1:112078116-112078138 CCAGTTGTGCAGGCTATGTTAGG + Intergenic
923042820 1:230332036-230332058 CATGTTGTGTGTGCTGTGTGTGG - Intronic
924144469 1:241059794-241059816 CCTGTTGAACTTGATGTGTAAGG - Intronic
924669460 1:246108688-246108710 CCTGTAGTTCCTGTTGTGTACGG + Intronic
1063932949 10:11047448-11047470 GCTGTTGTGCATTGTGGGTATGG + Intronic
1066932463 10:41781065-41781087 CTTTTTGTCCATTCTGTGTATGG + Intergenic
1075130423 10:119733542-119733564 TCTGCTGTGCATGCTCTGAAAGG - Intronic
1075512110 10:123081110-123081132 CCTGCTGTGCCTGATGGGTATGG + Intergenic
1075953348 10:126501224-126501246 CACGTTGTGCAGGCTGTGCAAGG + Intronic
1077574650 11:3373174-3373196 CCTGTTCTGCATGCAGCTTATGG + Intronic
1078007615 11:7544419-7544441 TCTGTTGTCCATGCTGTGTAAGG + Intronic
1079095755 11:17509325-17509347 CCTGTTCTGCATGCTATGTTTGG - Intronic
1081520884 11:43880343-43880365 CCTGCTGTAAATGCTGTGTTCGG + Intergenic
1083169177 11:60912663-60912685 CCTGTTGTGAGTCCTGTGAAAGG - Intergenic
1086739725 11:90352378-90352400 CTTGGTGTGCAGCCTGTGTATGG + Intergenic
1089489918 11:118876384-118876406 CCTGTTTGGCATTCTGTGTTTGG + Intergenic
1093264117 12:16980661-16980683 CCTTTTGTGTATGTTGTATAAGG + Intergenic
1094572887 12:31657402-31657424 CCTGTTTTTCATGCTTTGTCTGG + Intronic
1094863634 12:34501269-34501291 CTTTTTGTGCATTCTGTGAATGG - Intergenic
1095274977 12:40270890-40270912 CCTGTGGTGCATTCTGAGTTTGG + Intronic
1095695573 12:45140147-45140169 CATCTTGGGCATCCTGTGTATGG - Intergenic
1095780166 12:46049950-46049972 ACTGTAGTGAATGCTGGGTAGGG - Intergenic
1098337721 12:69420865-69420887 CCTGTTCTGGATGCTGTACATGG + Intergenic
1100358049 12:93850198-93850220 CCCGTTGTGCAGGCTCTGGAAGG - Exonic
1101716784 12:107319113-107319135 GCTGTTGTGCCGGCTGTGCATGG - Exonic
1103704925 12:122866210-122866232 CCTTTTGTGCAAGCAGTGCACGG - Exonic
1104928828 12:132327900-132327922 CCGGATGTGCCTGCTGTGTGTGG - Intronic
1105333396 13:19439364-19439386 ACTGTAGAGCATGCTGGGTAGGG - Intronic
1105878320 13:24580427-24580449 GCTGTAGAGCATGCTGGGTAGGG + Intergenic
1105921533 13:24968645-24968667 GCTGTAGAGCATGCTGGGTAGGG - Intergenic
1106587828 13:31072579-31072601 CCTGTTGTGTTTGCTGTTTATGG + Intergenic
1108115150 13:47119264-47119286 ATAGTTGTGGATGCTGTGTAGGG + Intergenic
1111395648 13:87665600-87665622 CCTGATTTGCATTCTGTTTAGGG - Intergenic
1116380238 14:44258670-44258692 TCTGTTCTGCATGATGTGCAGGG + Intergenic
1120246542 14:82012541-82012563 ACTGTTGTGTATGTTGGGTAGGG - Intergenic
1124166329 15:27328908-27328930 CGGGGTGTGCATGCTGTGTGAGG + Intronic
1124368902 15:29092134-29092156 CCTGTTTTACATACTGTCTACGG + Intronic
1126122048 15:45262084-45262106 CCTGTTGGGCCTGTTGTGTTTGG + Exonic
1129371454 15:75098517-75098539 CCAGTTGGGCAGGCTGGGTAGGG - Intronic
1133277519 16:4647816-4647838 CCTGTTCTGCATGCTGGGTTAGG + Intronic
1135054320 16:19218430-19218452 CCTGTTGTGCATGCTGTGTATGG + Intronic
1136739944 16:32509793-32509815 GCTTTTGTGCATTCTGTGAATGG - Intergenic
1140473927 16:75229271-75229293 CCCGTGGTGCATGCTGGGGAAGG + Exonic
1141027176 16:80559640-80559662 GCTGGTGTGCATGGTGTTTAAGG + Intergenic
1141215505 16:82019758-82019780 CCTGTGGTCCATGCTGTGCTTGG - Intergenic
1203012966 16_KI270728v1_random:317544-317566 GCTTTTGTGCATTCTGTGAATGG + Intergenic
1203031301 16_KI270728v1_random:590703-590725 GCTTTTGTGCATTCTGTGAATGG + Intergenic
1203040420 16_KI270728v1_random:743728-743750 GCTTTTGTGCATTCTGTGAATGG - Intergenic
1143411058 17:6709189-6709211 CCTGTTCTGGATGCTGAGGACGG - Intronic
1144224826 17:13134959-13134981 TTTGTTGTGCATGCTGTGCGTGG + Intergenic
1147196484 17:38770134-38770156 CCTGTTGTGCATCTTGTTGAAGG - Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1155556024 18:27020240-27020262 AGTGTGGTTCATGCTGTGTAGGG + Intronic
1156323234 18:36047995-36048017 CCTTTTTTGGATGCTGTGTCTGG - Intronic
1157491237 18:48125294-48125316 CCTGCTGTGGAAGCCGTGTAAGG + Intronic
1159001305 18:62977924-62977946 CCAGCTATGCTTGCTGTGTAAGG + Intronic
1159349809 18:67258089-67258111 CCTGTTTTGCAGGCTGGGGAGGG + Intergenic
1161290286 19:3490500-3490522 CCTGTTGTGGGTGCAGTGGAAGG - Intergenic
1161799545 19:6409067-6409089 CCTCTTGTGAATGCTGGTTATGG - Intergenic
1162546750 19:11335470-11335492 CGTGTTGTGCCTGCTGAGGATGG - Exonic
1165796878 19:38524831-38524853 GGGGTTGTGCATGCTGTGGAGGG + Intronic
1168636223 19:57999452-57999474 CCTGCTGTGCCTGCTGTGAAGGG - Intronic
926508103 2:13740933-13740955 CCTGTGCTGCATGCAGTCTAGGG + Intergenic
931284376 2:60820051-60820073 CCTGTTGTGCATCCTGCGGGGGG - Intergenic
932011180 2:67978721-67978743 GACCTTGTGCATGCTGTGTAGGG - Intergenic
934210157 2:89968858-89968880 CCTCATGTCCATGCTGTGTCCGG - Intergenic
936704329 2:115053710-115053732 CTTGTTGTGCATTCTATGTGAGG + Intronic
937498564 2:122451409-122451431 ACTGTGGTGTATGTTGTGTATGG - Intergenic
938119219 2:128622146-128622168 CCTCTTGTCCACGCTGTGTTTGG + Intergenic
941626290 2:167834367-167834389 CTTATTGTGCATCCTTTGTAAGG + Intergenic
947244313 2:228030185-228030207 CCTGATGTGCATGCAATGTGGGG + Intronic
1172335916 20:34115253-34115275 CCTGTTTTGCTGGCTGTATATGG - Intergenic
1173038206 20:39433287-39433309 TCTGTTGTGCATGCTCTGCATGG - Intergenic
1174366677 20:50060797-50060819 GCTGTTGTTCAGGCTGTGTTGGG + Intergenic
1174382087 20:50162463-50162485 CCTGGTGTGCATGCAGGGAATGG + Intergenic
1175037335 20:56012308-56012330 CCTGTTGTTCATCCCCTGTAGGG - Intergenic
1175529706 20:59666083-59666105 CCTGTTGTGCATGCCTTGCAGGG + Intronic
1176059507 20:63166246-63166268 CCTGGGGTGCATGCTGTCTGAGG - Intergenic
1176739647 21:10589229-10589251 ACTGTAGAGCATGCTGGGTAGGG + Intronic
1179678430 21:43000757-43000779 CCTGTAGTTCCTGCTGTTTAGGG + Intronic
1182132172 22:27862844-27862866 CCTGTTGTGGATGCTGGCTTGGG + Intronic
1183747125 22:39698375-39698397 CCTGTGGTGCATGGGGTGGAGGG + Intergenic
1184897853 22:47422500-47422522 CCAGTTTTGCAGGCTGCGTATGG + Intergenic
951655190 3:24999367-24999389 GCTGGTGTGCATGCTGAGTTTGG + Intergenic
952010758 3:28898134-28898156 ATGTTTGTGCATGCTGTGTAAGG + Intergenic
956304252 3:67806379-67806401 TCTGTTCTGCATGCTGTTTGTGG + Intergenic
956392628 3:68789664-68789686 CCTCTTGAGCATCATGTGTAGGG - Intronic
958837927 3:99168790-99168812 CCTGTTGGGCATGCTGGGGAGGG - Intergenic
959610048 3:108283517-108283539 CATGTTGTGCATGTTGTAGAAGG - Intergenic
961656868 3:128447515-128447537 ACAGTGGTGCATGCAGTGTAGGG - Intergenic
963308343 3:143679216-143679238 CCAGTTGTGCATGCTTTGTGTGG - Intronic
963636052 3:147797637-147797659 CATGTTGTACATGCTATTTAAGG - Intergenic
965108378 3:164388006-164388028 CATGTGGTGCAAGCTGTGTGTGG + Intergenic
967614401 3:191547518-191547540 CCTGTTGTGTGTGCAGTCTAGGG - Intergenic
969217010 4:5730909-5730931 CGTGGTGTGCATGGTGTGCATGG + Intronic
969240789 4:5895888-5895910 CCTGTTTTGCATGCAGTCTTGGG + Intergenic
971982328 4:33768561-33768583 CAGTTTGTGCATGCTGTGTGTGG + Intergenic
976362984 4:84202501-84202523 CCTGTTGTGCTTCCTGGGTGAGG - Intergenic
977707341 4:100086526-100086548 CCTGGTGGGGATGCTGTGTGTGG + Intergenic
978250097 4:106620305-106620327 CCTGTAGGGCAGGCTTTGTAAGG + Intergenic
979381565 4:120012468-120012490 ACTGTTTTGCATGTTGTGTCTGG - Intergenic
981193701 4:141893290-141893312 CCTGAAGTTCATGCTGTGAAAGG - Intergenic
981317767 4:143357572-143357594 CCTGTTGTGAAGGGTGGGTAGGG + Intronic
985794738 5:1953610-1953632 CCTGTTGTGCTTCCTGGGTGAGG - Intergenic
988712536 5:33792975-33792997 GCTGTTGTGCTTGATGTTTAGGG - Intronic
989832618 5:45939365-45939387 ACTGTTGTCCATTCTGTGAATGG + Intergenic
991644930 5:68792309-68792331 CCTGTTGCACATCCTGTGAAGGG - Intergenic
992987713 5:82250641-82250663 CCTGTTGTGTTTCCTTTGTAGGG + Intronic
996701079 5:126450968-126450990 CCTGTTGGGCACTCTGTGTGGGG - Intronic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
1000583769 5:163068973-163068995 CCTGTTGTGCAATCTGTTGATGG + Intergenic
1001299163 5:170521629-170521651 CCGATGGTGCATGCTGTGTGTGG - Intronic
1003802013 6:9680810-9680832 CCTGCTGTGCATGCACTGTCAGG + Intronic
1004337068 6:14773755-14773777 CTACTTTTGCATGCTGTGTAAGG + Intergenic
1005972523 6:30772486-30772508 CCTGATCTGCATCCTGTGTTAGG + Intergenic
1007947459 6:45839148-45839170 GCTGGTGTGCAAGCTGTGTCAGG - Intergenic
1007965766 6:46002471-46002493 CCTGTTGTGCATTGTGGGTGTGG - Intronic
1009242477 6:61198943-61198965 CCCAGTGTGGATGCTGTGTAGGG - Intergenic
1009413156 6:63389997-63390019 CCTTTTGTGAATGCTAAGTAGGG + Intergenic
1010661704 6:78578943-78578965 CATGTTTTGGATGCTGTGCAGGG + Intergenic
1016076494 6:139802808-139802830 CATTTTGTGGAGGCTGTGTAAGG + Intergenic
1017873220 6:158503305-158503327 CCTGTTGTGCAAACTGCGTTGGG - Exonic
1018718518 6:166554507-166554529 CCGGATGTGCATCCTGTGTGGGG + Intronic
1020143781 7:5627288-5627310 ACTGGTGTGGCTGCTGTGTATGG - Intronic
1020639825 7:10741787-10741809 CCCCTTGTGCTTCCTGTGTAAGG - Intergenic
1020737594 7:11970585-11970607 CCTGCTTTTCATCCTGTGTATGG - Intergenic
1023248241 7:38230430-38230452 CTTGTTTTGCATTATGTGTATGG + Exonic
1025527401 7:61832780-61832802 GCTTTTGTGCATTCTGTGAATGG - Intergenic
1025911236 7:65830443-65830465 CCTGTTGTTCAGGGTGTTTATGG + Intergenic
1025978425 7:66388012-66388034 CCTGTTGTTCAGGGTGTTTATGG - Intronic
1027204005 7:76082683-76082705 CCTGTTGTTCAGGGTGTTTATGG - Intergenic
1030361053 7:108595938-108595960 CCTGAAGTGCATGTTGGGTAGGG - Intergenic
1032056105 7:128685491-128685513 CCTCTTGTGCATGCTCAGTTGGG + Intronic
1032572647 7:133016792-133016814 CCTGTTGGTAATGCTGTGTTAGG - Intronic
1034699475 7:153083838-153083860 CCAGTTCTGCAGGCTGTGCAGGG + Intergenic
1036221156 8:6922683-6922705 CCTGCTCTGTCTGCTGTGTAGGG - Intergenic
1039641464 8:39227653-39227675 CCTGCTGTGGCTGCTGTGTGGGG - Intronic
1039869437 8:41533157-41533179 CCTGTTATTCATGCTGTTTCAGG - Intronic
1042511746 8:69619706-69619728 CCTGTTGCACATCCTGTGAAGGG - Intronic
1042610983 8:70600941-70600963 CCTGATGTGCATCCTGTGCCTGG - Intronic
1048952579 8:139508513-139508535 ACTTGTGTGCATGCTGTGTGGGG - Intergenic
1049601142 8:143508230-143508252 CCTGTTGCGGATACTGTCTAGGG - Intronic
1057167604 9:92941068-92941090 CCAGTTGTCCATGCTGTGTTTGG - Intergenic
1062037805 9:134390440-134390462 GCTGCCGTGCCTGCTGTGTAGGG - Intronic
1062146973 9:134994906-134994928 CCTGCTGGGCATGCTGTGTTAGG + Intergenic
1185826709 X:3258119-3258141 CCTAGTGAGCATGCTTTGTAAGG + Intergenic
1190455344 X:50622172-50622194 CCTGTTGTGGCTGCTGTTAATGG + Intronic
1192919065 X:75686324-75686346 CCTCTTGTGCTTCCTGTGTGAGG + Intergenic
1193068519 X:77282702-77282724 CCTCTTGTGCTTGCTGGGTGAGG - Intergenic
1193277250 X:79603433-79603455 ACTGTAATGTATGCTGTGTATGG - Intergenic
1194034741 X:88856019-88856041 TCTGTTGTGCTTGTTGTATATGG + Intergenic
1194333380 X:92614380-92614402 ACTGTAGTGAATGCTGGGTATGG + Intronic
1194508007 X:94757093-94757115 CCTATTGGCCATGCTGAGTAGGG - Intergenic
1195300728 X:103527641-103527663 TCTGATGTGCATGCTGGTTAAGG + Intergenic
1195766589 X:108302736-108302758 CCTGTTGTGCATACTCTGTAAGG - Intronic
1198945617 X:142010059-142010081 CCTGTTGTGAATGTTGTGATTGG + Intergenic
1200043893 X:153389393-153389415 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200043899 X:153389457-153389479 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200043905 X:153389523-153389545 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200043934 X:153389874-153389896 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200043945 X:153389995-153390017 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200043950 X:153390054-153390076 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200043955 X:153390107-153390129 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200043961 X:153390173-153390195 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200043964 X:153390208-153390230 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200043975 X:153390329-153390351 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200043978 X:153390364-153390386 CATGGTGTGCATGGTGTGTGTGG - Intergenic
1200043995 X:153390552-153390574 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200044005 X:153390658-153390680 CGTGGTGTGCATGTTGTGTGTGG - Intergenic
1200044007 X:153390691-153390713 CGTGGTGTGCATGTTGTGTGTGG - Intergenic
1200044009 X:153390726-153390748 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200044027 X:153390934-153390956 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200044054 X:153391235-153391257 CATGGTGTGCATGGTGTGTGTGG - Intergenic
1200044060 X:153391299-153391321 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200044063 X:153391334-153391356 CGTGGTGTGCATGGTGTGCATGG - Intergenic
1200044066 X:153391369-153391391 CATGGTGTGCATGGTGTGTGTGG - Intergenic
1200044079 X:153391492-153391514 CATGGTGTGCATGGTGTGTGTGG - Intergenic
1200044082 X:153391523-153391545 CATGGTGTGCATGGTGTGTGTGG - Intergenic
1200044088 X:153391585-153391607 CGTGGTGTGCATGGTGTGTGTGG - Intergenic
1200642064 Y:5733386-5733408 ACTGTAGTGAATGCTGGGTATGG + Intronic