ID: 1135061641

View in Genome Browser
Species Human (GRCh38)
Location 16:19276033-19276055
Sequence AGTTATCTGCGGATGATGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135061635_1135061641 16 Left 1135061635 16:19275994-19276016 CCAAGTATCACGCCAAGAGCCAT No data
Right 1135061641 16:19276033-19276055 AGTTATCTGCGGATGATGCACGG No data
1135061639_1135061641 -3 Left 1135061639 16:19276013-19276035 CCATCTCTCAACAGGAGAGGAGT No data
Right 1135061641 16:19276033-19276055 AGTTATCTGCGGATGATGCACGG No data
1135061637_1135061641 4 Left 1135061637 16:19276006-19276028 CCAAGAGCCATCTCTCAACAGGA No data
Right 1135061641 16:19276033-19276055 AGTTATCTGCGGATGATGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135061641 Original CRISPR AGTTATCTGCGGATGATGCA CGG Intergenic
No off target data available for this crispr