ID: 1135063118

View in Genome Browser
Species Human (GRCh38)
Location 16:19287618-19287640
Sequence TGCCCAGCAAAAGTGGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135063112_1135063118 -6 Left 1135063112 16:19287601-19287623 CCAAGATCTTGCCTTTCTGCCCA No data
Right 1135063118 16:19287618-19287640 TGCCCAGCAAAAGTGGGAAGGGG No data
1135063109_1135063118 19 Left 1135063109 16:19287576-19287598 CCTTGCAGACTGCGCCTCGTATA No data
Right 1135063118 16:19287618-19287640 TGCCCAGCAAAAGTGGGAAGGGG No data
1135063111_1135063118 -5 Left 1135063111 16:19287600-19287622 CCCAAGATCTTGCCTTTCTGCCC No data
Right 1135063118 16:19287618-19287640 TGCCCAGCAAAAGTGGGAAGGGG No data
1135063110_1135063118 5 Left 1135063110 16:19287590-19287612 CCTCGTATATCCCAAGATCTTGC No data
Right 1135063118 16:19287618-19287640 TGCCCAGCAAAAGTGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135063118 Original CRISPR TGCCCAGCAAAAGTGGGAAG GGG Intronic
No off target data available for this crispr