ID: 1135063911

View in Genome Browser
Species Human (GRCh38)
Location 16:19293214-19293236
Sequence TACTCTCTCTAGTATTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135063911_1135063914 2 Left 1135063911 16:19293214-19293236 CCCAGCCAATACTAGAGAGAGTA No data
Right 1135063914 16:19293239-19293261 TTATGTCAAATAAAACATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135063911 Original CRISPR TACTCTCTCTAGTATTGGCT GGG (reversed) Intronic
No off target data available for this crispr