ID: 1135065428

View in Genome Browser
Species Human (GRCh38)
Location 16:19305583-19305605
Sequence TCTGCCACTTACTGGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135065421_1135065428 25 Left 1135065421 16:19305535-19305557 CCTTGCTCAGGGCACTATAGGGA No data
Right 1135065428 16:19305583-19305605 TCTGCCACTTACTGGCTGGCAGG No data
1135065423_1135065428 -6 Left 1135065423 16:19305566-19305588 CCAGTGCCAGCTCCTTTTCTGCC No data
Right 1135065428 16:19305583-19305605 TCTGCCACTTACTGGCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135065428 Original CRISPR TCTGCCACTTACTGGCTGGC AGG Intronic
No off target data available for this crispr